Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10113

Sh3glb2 SH3-domain GRB2-like endophilin B2 ( MGI:2385131)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10113 EMAGE:10113 EMAGE:10113 EMAGE:10113 EMAGE:10113
"Pseudo-wholemount" of euxassay_000047. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000047_01 euxassay_000047_02 euxassay_000047_03 euxassay_000047_04
EMAGE:10113 EMAGE:10113 EMAGE:10113 EMAGE:10113 EMAGE:10113
euxassay_000047_05 euxassay_000047_06 euxassay_000047_07 euxassay_000047_08 euxassay_000047_09
EMAGE:10113 EMAGE:10113 EMAGE:10113 EMAGE:10113 EMAGE:10113
euxassay_000047_10 euxassay_000047_11 euxassay_000047_12 euxassay_000047_13 euxassay_000047_14
EMAGE:10113 EMAGE:10113 EMAGE:10113 EMAGE:10113 EMAGE:10113
euxassay_000047_15 euxassay_000047_16 euxassay_000047_17 euxassay_000047_18 euxassay_000047_19
EMAGE:10113 EMAGE:10113 EMAGE:10113 EMAGE:10113 EMAGE:10113
euxassay_000047_20 euxassay_000047_21 euxassay_000047_22 euxassay_000047_23 euxassay_000047_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10113Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10113_wholemount_strong.wlz
10113_wholemount_moderate.wlz
10113_wholemount_weak.wlz
10113_wholemount_possible.wlz
10113_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10113_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 05 06 08 20 21 22 weak expression: see section 04 09 23 24
arm
moderate moderate
regionalmoderate expression: see section 01 02
leg
moderate moderate
regionalmoderate expression: see section 01 02
femur
moderate moderate
regionalmoderate expression: see section 23 24 weak expression: see section 04 05
diencephalon
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
telencephalon
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
cerebral cortex
moderate moderate
regionalmoderate expression: see section 02 03 04 weak expression: see section 01
medulla oblongata
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
metencephalon
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
cerebellum
moderate moderate
regionalmoderate expression: see section 05 06 07 08
midbrain
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
facial vii ganglion
moderate moderate
homogeneousmoderate expression: see section 05 06 20 21 22
glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 05 06 20
trigeminal v ganglion
moderate moderate
homogeneousmoderate expression: see section 04 05 06 07 08 09 18 19 20 21 22 23 24
vagus x ganglion
moderate moderate
homogeneousmoderate expression: see section 07 08 09 10 11 18 19 20
vestibulocochlear viii ganglion
moderate moderate
homogeneousmoderate expression: see section 08 09 18 19 20 21
spinal cord
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16
dorsal root ganglion
moderate moderate
homogeneousmoderate expression: see section 08 09 10 11 12 17 18
lens
moderate moderate
regionalmoderate expression: see section 01
neural retina
weak weak
regionalweak expression: see section 02 03 24
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
lung
moderate moderate
spottedmoderate expression: see section 04 weak expression: see section 05 08
thoracic vertebra
weak weak
regionalweak expression: see section 03
clavicle
weak weak
regionalweak expression: see section 03 04
scapula
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 03 04
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1498
Entity Detected:Sh3glb2, SH3-domain GRB2-like endophilin B2 ( MGI:2385131)
Sequence:sense strand is shown

>T1498
TTTTTTTTTTTTTTCGCACACAAAGGATTTATTTGCCAGAGAGCAAGCAGACAGGCAGAGGTCAGAATGT
TAGTTAGAAACTGAAGGAATGACTGCTGTAGCCACTGTGCCCAGCCAGAGCCATGAGGGAAGTGGGAGGC
AGCACTTGGTGCTGCTGCTCTGGCTGACCCTTCTGGTTTCCTGCCACACTCCTAGCCCTGCCTGTGTGCT
GCTGTCCCCCTCAACCTTCCACAGCCAGAAGGCAGATGTTCTTTCATGCCAAGAGCATCCATCCCCAGCA
TATCCTGGGCCCATGGTGGTGTCAAATGTAGTGACCCTTTCTGCCTTAAGGGAGCTGGGAAGCCTGGGGT
GTGCAGGGTTGCAGGTCAAAAGCAGGACTANCANANG
Notes:The probe template was PCR amplified from IMAGE:538849 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:538849 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10115 same embryo
 EMAGE:10114 same embryo
 EMAGE:10116 same embryo
 EMAGE:10112 same embryo
 EurExpress:euxassay_000047 same experiment
 MGI:4828040 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS