Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10312

Vasn vasorin ( MGI:2177651)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10312 EMAGE:10312 EMAGE:10312 EMAGE:10312 EMAGE:10312
"Pseudo-wholemount" of euxassay_000303. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000303_01 euxassay_000303_02 euxassay_000303_03 euxassay_000303_04
EMAGE:10312 EMAGE:10312 EMAGE:10312 EMAGE:10312 EMAGE:10312
euxassay_000303_05 euxassay_000303_06 euxassay_000303_07 euxassay_000303_08 euxassay_000303_09
EMAGE:10312 EMAGE:10312 EMAGE:10312 EMAGE:10312 EMAGE:10312
euxassay_000303_10 euxassay_000303_11 euxassay_000303_12 euxassay_000303_13 euxassay_000303_14
EMAGE:10312 EMAGE:10312 EMAGE:10312 EMAGE:10312 EMAGE:10312
euxassay_000303_15 euxassay_000303_16 euxassay_000303_17 euxassay_000303_18 euxassay_000303_19
EMAGE:10312 EMAGE:10312 EMAGE:10312 EMAGE:10312 EMAGE:10312
euxassay_000303_20 euxassay_000303_21 euxassay_000303_22 euxassay_000303_23 euxassay_000303_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10312Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10312_wholemount_strong.wlz
10312_wholemount_moderate.wlz
10312_wholemount_weak.wlz
10312_wholemount_possible.wlz
10312_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10312_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
basioccipital bone
moderate moderate
homogeneousmoderate expression: see section 12 weak expression: see section 23
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 06 07 weak expression: see section 02 03 04 05 23
temporal bone
weak weak
homogeneousweak expression: see section 23
temporal bone petrous part
weak weak
regionalweak expression: see section 02 22
temporo-mandibular joint primordium
moderate moderate
regionalmoderate expression: see section 09 10 19 weak expression: see section 02 04 05
ethmoid bone primordium
moderate moderate
homogeneousmoderate expression: see section 07 08 14 16 19 22 weak expression: see section 23
facial bone primordium
moderate moderate
homogeneousmoderate expression: see section 10
optic foramen
moderate moderate
homogeneousmoderate expression: see section 08
orbital fissure
moderate moderate
homogeneousmoderate expression: see section 10
orbito-sphenoid
moderate moderate
homogeneousmoderate expression: see section 09 11 18 19 20 22
viscerocranium
moderate moderate
homogeneousExpression in the turbinate bone.
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3619
Entity Detected:Vasn, vasorin ( MGI:2177651)
Sequence:sense strand is shown

>T3619
GTAACATGGCTAGGCATGTTGGGCTTCCCAAACCATGGAGTCTGGTAACCAGTGAAGGAAGCCCCCAGAA
ATAATGAGTGGGGAAGGTACTAGGGCACTGGCCTTGGCCTCAAAAGTGCAGGCACACTTGAAACTGGAAA
GGAAGGTGCTCTGGGCACATGTGGATTTGCTTCTATTGTTTTGTTTTGTTTTTTCTAATGTATTTATAAA
AGATCTTTTCCCATTTATGCTGGGAAAGTGTTTTTCAAACTCAGTGACAAGGACTTTGGTTTTTGTAAGA
CTGTTGATGATATGAAGGCCTTTTGTAAGAAAATAAAAAATAAAGTAAATTGCCTGTCAAAAAAAAAAAA
AAA
Notes:The probe template was PCR amplified from IMAGE:3167947 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3167947 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10315 same embryo
 EMAGE:10314 same embryo
 EMAGE:10316 same embryo
 EMAGE:10313 same embryo
 EurExpress:euxassay_000303 same experiment
 MGI:4829149 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS