Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10357

Synj1 synaptojanin 1 ( MGI:1354961)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10357 EMAGE:10357 EMAGE:10357 EMAGE:10357 EMAGE:10357
"Pseudo-wholemount" of euxassay_003353. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_003353_01 euxassay_003353_02 euxassay_003353_03 euxassay_003353_04
EMAGE:10357 EMAGE:10357 EMAGE:10357 EMAGE:10357 EMAGE:10357
euxassay_003353_05 euxassay_003353_06 euxassay_003353_07 euxassay_003353_08 euxassay_003353_09
EMAGE:10357 EMAGE:10357 EMAGE:10357 EMAGE:10357 EMAGE:10357
euxassay_003353_10 euxassay_003353_11 euxassay_003353_12 euxassay_003353_13 euxassay_003353_14
EMAGE:10357 EMAGE:10357 EMAGE:10357 EMAGE:10357 EMAGE:10357
euxassay_003353_15 euxassay_003353_16 euxassay_003353_17 euxassay_003353_18 euxassay_003353_19
EMAGE:10357 EMAGE:10357 EMAGE:10357 EMAGE:10357 EMAGE:10357
euxassay_003353_20 euxassay_003353_21 euxassay_003353_22 euxassay_003353_23 euxassay_003353_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10357Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10357_wholemount_strong.wlz
10357_wholemount_moderate.wlz
10357_wholemount_weak.wlz
10357_wholemount_possible.wlz
10357_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10357_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
facial vii ganglion
weak weak
regionalweak expression: see section 03 04 19 20 21
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 07 18 19
trigeminal v ganglion
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 17 18 19 20 21 22
vagus x ganglion
weak weak
regionalweak expression: see section 08 17
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 06 07 17 18 19
spinal cord
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16 17 18 19
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 19 weak expression: see section 09 10 13 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T6333
Entity Detected:Synj1, synaptojanin 1 ( MGI:1354961)
Sequence:sense strand is shown

>T6333
AGAGTGACCCATTTGAAGATCTCTCACTTAGTGTGCTTGCTGTATCAAAGGCTCAGCCTTCTGTTCAGAT
TTCACCTGTTCTAACCCCAGACCCAAAGATGTTGATTCAGTTGCCTTCTGCATCGCAAAGTCAAGTTAAC
CCTTTGAGTTCTGTAAGTTGCATGCCAACCAGGCCTCCAGGTCCAGAGGAAAGCAAGTCACAGGAGAGTA
TGGGCAGTTCTGCAAACCCGTTTCCCAGCCTGCCCTGCCGGAACCCTTTTACAGACAGGACTGCTGCCCC
TGGAAACCCATTTAGAGTTCAGTCCCAAGAATCAGAGGCAACTTCTTGGCTCTCCAAAGAAGAGCCTGTT
CCCAACAGTCCCTTCCCTCCTCTCATGCCTCTCAGTCATGACACGAGCAAGGCTTCAAGTTCGCTTGGTG
GCTTTGAGGACAATTTTGATCTGCAGAGCCAGTCTACAGTAAAAACAAGCAACCCCAAAGGATGGGTAAC
CTTTGACGAAGACGACAACTTTCCTACAACAGGAAAGTCAAAGTCAGTTTGTCCAGACTTAGTGGGTAAC
GCGCCAGCTTCATTTGATGATGACTGGAGTAAAGGTGCGAGCGTTTCTTTCTGTGTGTTGCCAGCC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:TTTTCCAGGTAAAAATAAATGG; Reverse Primer - name:unspecified, sequence:GAAGTCCAATGTGGAAGGTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10361 same embryo
 EMAGE:10356 same embryo
 EMAGE:10358 same embryo
 EMAGE:10360 same embryo
 EMAGE:10359 same embryo
 EurExpress:euxassay_003353 same experiment
 MGI:4828558 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS