Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10616

Fam164a family with sequence similarity 164, member A ( MGI:1914556)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10616 EMAGE:10616 EMAGE:10616 EMAGE:10616 EMAGE:10616
"Pseudo-wholemount" of euxassay_000836. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000836_01 euxassay_000836_02 euxassay_000836_03 euxassay_000836_04
EMAGE:10616 EMAGE:10616 EMAGE:10616 EMAGE:10616 EMAGE:10616
euxassay_000836_05 euxassay_000836_06 euxassay_000836_07 euxassay_000836_08 euxassay_000836_09
EMAGE:10616 EMAGE:10616 EMAGE:10616 EMAGE:10616 EMAGE:10616
euxassay_000836_10 euxassay_000836_11 euxassay_000836_12 euxassay_000836_13 euxassay_000836_14
EMAGE:10616 EMAGE:10616 EMAGE:10616 EMAGE:10616 EMAGE:10616
euxassay_000836_15 euxassay_000836_16 euxassay_000836_17 euxassay_000836_18 euxassay_000836_19
EMAGE:10616 EMAGE:10616 EMAGE:10616
euxassay_000836_20 euxassay_000836_21 euxassay_000836_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10616Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10616_wholemount_strong.wlz
10616_wholemount_moderate.wlz
10616_wholemount_weak.wlz
10616_wholemount_possible.wlz
10616_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10616_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon
moderate moderate
homogeneousmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
telencephalon
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
hindbrain
moderate moderate
homogeneousmoderate expression: see section 06 07 08 11 12 13 14 15 16 17 18 not examined expression: see section 05
medulla oblongata
moderate moderate
homogeneousmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
metencephalon
moderate moderate
homogeneousmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
midbrain
moderate moderate
homogeneousmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
facial vii ganglion
strong strong
homogeneousstrong expression: see section 05 06 08 20 21 22
inferior glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 07 08 18 20
superior glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 08 18
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 04 05 06 07 08 09 10 17 18 20 21 22
vagus x ganglion
strong strong
homogeneousstrong expression: see section 09 10 11 17
vestibulocochlear viii ganglion cochlear component
strong strong
homogeneousstrong expression: see section 07 08 09 18 20
vestibulocochlear viii ganglion vestibular component
strong strong
homogeneousstrong expression: see section 06 07 08 09 18 20 21
spinal cord
moderate moderate
homogeneousmoderate expression: see section 11 12 13 14 15 16
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 17 18 19 20
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 15 16 17 18 19
not examined not examined
homogeneousExpression in the turbinate bone.
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1003
Entity Detected:Fam164a, family with sequence similarity 164, member A ( MGI:1914556)
Sequence:sense strand is shown

>T1003
TCCTCGAGNCTGTTGGCCTACTGGAGGCGGCGCGTCATGGACGGACTGGAAGAAAATGGAAGTGTTGTGC
AAGTTGGAGACTTGTTGCCCTGCAAGATTTGCGGAAGGACCTTCTTCCCGTTGGCTCTGAAAAAACATGG
ACCTATTTGCCAGAAAACTGCCACTAAGAAGCGGAAGACTTTTGATTCCAGCCGGCAGAGAGCTGAAGGG
ACTGATATTCCCACGGTCAAACCTCTCAAACCCAGGCCAGAACCACCAAAGAAGCCATCCAATTGGAGAC
GAAAGCACGAGGAGTTCATTGCCACCATCAGAGCAGCGAAAGGCCTGGACCAGGCTCTCAAGGAGGGCGG
CAAGCTGCCTCCTCCTCCTCCGCCCTCTTACGACCCAGATTACATCCAGTGTCCGTATTGCCAGAGGAGA
TTCAATGAAAATGCAGCCGACAGACATATAAACTTTTGTAAAGAACAGGCAGCACGTATTAGTAATAAGG
GCAAATTTTCTACTGATTCTAAAGGAAAGCCAGCTTCTCGGCCACAGTATAAGCCGTCTCCGCTTAAA
Notes:The probe template was PCR amplified from IMAGE:2064672 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2064672 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10617 same embryo
 EMAGE:10615 same embryo
 EMAGE:10614 same embryo
 EurExpress:euxassay_000836 same experiment
 MGI:4824717 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS