EMAGE mouse gene expression spatial database

EMAGE:10809

Fam25c family with sequence similarity 25, member C ( MGI:1916384)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_003038. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_003038_01	euxassay_003038_02	euxassay_003038_03	euxassay_003038_04

euxassay_003038_05	euxassay_003038_06	euxassay_003038_07	euxassay_003038_08	euxassay_003038_09

euxassay_003038_10	euxassay_003038_11	euxassay_003038_12	euxassay_003038_13	euxassay_003038_14

euxassay_003038_15	euxassay_003038_16	euxassay_003038_17	euxassay_003038_18	euxassay_003038_19

euxassay_003038_20	euxassay_003038_21	euxassay_003038_22	euxassay_003038_23

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

submandibular gland primordium

moderate

regional

moderate expression: see section 05 06 08 16 17 18 weak expression: see section 07 15

vibrissa

strong

regional

strong expression: see section 04 moderate expression: see section 05 06 20 21 22

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T1127
Entity Detected:	Fam25c, family with sequence similarity 25, member C ( MGI:1916384)
Sequence:	sense strand is shown >T1127 TCGAGCCTGTTGGCCTACTGGGAGCAAGCTTTACCTGTCACTGTCTGCTGCCATACGATGCTGGGAGGCC TGGGGAAGCTGGCGGCCGAGGGCCTGGCCCACCGCACAGAGAAAGCCACTGAGGGAGCAGTTCACGCAGT GGAAGAGGTGGTGAGCGAGGTGGTGGGCCACGCCAAGGAGGTTGGAGAGAAGGCCATTAATGACGCCCTA AAGAAAGCCCAAGAATCAGGAGACAGGGTGGTGAAGGAGGTCACTGAGAAGGTCACCCACACCATCACTG ATGCTGTTACCCATGCGGCAGAAGGCCTGGGAAGACTGGGACAGTGAGCCTGCCTACCAGCATGGCTGGC CCTTCCTGAAGGTCAATAAAGAGTGTGAAACGTGAAAAAAAAAAAAAAAAAAGGCCACAT
Notes:	The probe template was PCR amplified from IMAGE:2135553 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2135553 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:10811 same embryo
	EMAGE:10812 same embryo
	EMAGE:10807 same embryo
	EMAGE:10808 same embryo
	EMAGE:10806 same embryo
	EMAGE:10810 same embryo
	EurExpress:euxassay_003038 same experiment
	MGI:4822649 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source