Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11403

Hspb3 heat shock protein 3 ( MGI:1928479)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11403 EMAGE:11403 EMAGE:11403 EMAGE:11403 EMAGE:11403
"Pseudo-wholemount" of euxassay_006750. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006750_01 euxassay_006750_02 euxassay_006750_03 euxassay_006750_04
EMAGE:11403 EMAGE:11403 EMAGE:11403 EMAGE:11403 EMAGE:11403
euxassay_006750_05 euxassay_006750_06 euxassay_006750_07 euxassay_006750_08 euxassay_006750_09
EMAGE:11403 EMAGE:11403 EMAGE:11403 EMAGE:11403 EMAGE:11403
euxassay_006750_10 euxassay_006750_11 euxassay_006750_12 euxassay_006750_13 euxassay_006750_14
EMAGE:11403 EMAGE:11403 EMAGE:11403 EMAGE:11403 EMAGE:11403
euxassay_006750_15 euxassay_006750_16 euxassay_006750_17 euxassay_006750_18 euxassay_006750_19
EMAGE:11403 EMAGE:11403 EMAGE:11403 EMAGE:11403
euxassay_006750_20 euxassay_006750_21 euxassay_006750_22 euxassay_006750_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11403Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11403_wholemount_strong.wlz
11403_wholemount_moderate.wlz
11403_wholemount_weak.wlz
11403_wholemount_possible.wlz
11403_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11403_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 21 22 23
upper leg muscle
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 20 21 22 23
diaphragm
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
forearm rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02
hand
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06
foot
moderate moderate
regionalmoderate expression: see section 09 10 11
tarsus rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 23
lower leg rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
tongue muscle
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17
tongue extrinsic muscle
moderate moderate
regionalmoderate expression: see section 09
left lung
moderate moderate
spottedmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 weak expression: see section 04 05
right lung
moderate moderate
spottedmoderate expression: see section 15 16 17 18 19 20 21 22 23
tail paraxial mesenchyme
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T8188
Entity Detected:Hspb3, heat shock protein 3 ( MGI:1928479)
Sequence:sense strand is shown

>T8188
GTGAAAAGACAAGAGTCAGTGTGCCGGTCTGATTCAGCCCCAATTAAGCTGCCGTCTGGGCAGGACTGTA
AACGGAGCTGCTAGGACTAAGAATCGAGTCCGCAGGCAACGCCAGAGACTAGACACTCACGGAAGGGAAG
TGGTTCAACGCTGGAGTCGCCTCTGCTATGGCAAAAATCATTTTGAGGCACCTCATAGAGACCCCAGTGC
GTTATCAGGAGGAGTTTGAAGCTCGAGGCTTAGAAGACTGCAGACTGGATCATACACTATACGCACTGCC
CGGGCCAACCATCGAGGACCTGAGTAAAGCCAGAGGCGCAGGCACGCCACAGGCTCTGGCAGAGGACTCA
GCCTCCACGGAGAAGCCACCCGGAGAAGGCAAATCCCGTTTCCAGATCCTGCTGGATGTGGTCCAGTTCC
TGCCCGAGGACATCATCATCCAGACCTTCGAGGGCTGGCTGCTGATCAAGGCACAGCACGGAACCAGAAT
GGACGAACACGGGTTTATATCGCGGAGTTTCACCAGACAGTACAAACTGCCAGATGGAGTCGAAACCAAA
GATTTGTCTGCCATCCTCTGTCATGATGGAATCTTGGTGGTGGAAGTCAAAGATTCACTAGGGACCAAGT
GAAAGCCTTTTGGTTGCTCTTCATACCCCAGGAAGGAAGATGAAAGCCAGGGACACCCCGGGAATGCTTA
AACTTTTGAGATGGATTGCTGTCACTTTTATGAGGATTAAAAAAAAACCAAATGTAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAC
Notes:The probe template was PCR amplified from IMAGE:851802 using vector (pT7T3D-PacI) specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:851802 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11405 same embryo
 EMAGE:11404 same embryo
 EMAGE:11402 same embryo
 EMAGE:11401 same embryo
 EMAGE:11406 same embryo
 EurExpress:euxassay_006750 same experiment
 MGI:4825481 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS