Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11971

Lin7a lin-7 homolog A (C. elegans) ( MGI:2135609)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11971 EMAGE:11971 EMAGE:11971 EMAGE:11971 EMAGE:11971
"Pseudo-wholemount" of euxassay_011082. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011082_01 euxassay_011082_02 euxassay_011082_03 euxassay_011082_04
EMAGE:11971 EMAGE:11971 EMAGE:11971 EMAGE:11971 EMAGE:11971
euxassay_011082_05 euxassay_011082_06 euxassay_011082_07 euxassay_011082_08 euxassay_011082_09
EMAGE:11971 EMAGE:11971 EMAGE:11971 EMAGE:11971 EMAGE:11971
euxassay_011082_10 euxassay_011082_11 euxassay_011082_12 euxassay_011082_13 euxassay_011082_14
EMAGE:11971 EMAGE:11971 EMAGE:11971 EMAGE:11971 EMAGE:11971
euxassay_011082_15 euxassay_011082_16 euxassay_011082_17 euxassay_011082_18 euxassay_011082_19
EMAGE:11971 EMAGE:11971 EMAGE:11971 EMAGE:11971 EMAGE:11971
euxassay_011082_20 euxassay_011082_21 euxassay_011082_22 euxassay_011082_23 euxassay_011082_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11971Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11971_wholemount_strong.wlz
11971_wholemount_moderate.wlz
11971_wholemount_weak.wlz
11971_wholemount_possible.wlz
11971_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11971_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
telencephalon mantle layer
moderate moderate
single cellmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 12 13 14 15 16 17 18 19
facial vii ganglion
strong strong
regionalstrong expression: see section 05 06 moderate expression: see section 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 19 20 weak expression: see section 08
trigeminal v ganglion
strong strong
regionalstrong expression: see section 05 06 moderate expression: see section 04 07 09 10 18 19 20 21 22 23 24 weak expression: see section 08
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 19 weak expression: see section 09
ventral grey horn
moderate moderate
single cellmoderate expression: see section 10 11 12 13 14 15 17 weak expression: see section 16
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 11 17
cervical ganglion
weak weak
regionalweak expression: see section 10 18
thoracic ganglion
weak weak
regionalweak expression: see section 14 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 17 18 19 weak expression: see section 08
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 03 weak expression: see section 24
neural retina
weak weak
regionalweak expression: see section 01 02 03 04 24
genital tubercle of male
moderate moderate
regionalmoderate expression: see section 12 13 20 21 weak expression: see section 14 18 19
lung
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 17 18 19 20 21 22 23 24 weak expression: see section 04 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36590
Entity Detected:Lin7a, lin-7 homolog A (C. elegans) ( MGI:2135609)
Sequence:sense strand is shown

>T36590
AAAGCTGTGGAACTTCTCAAGGCTGCTAAGGACAGTGTGAAGCTGGTGGTCAGATACACCCCAAAAGTCC
TGGAAGAGATGGAGGCTCGTTTCGAGAAGCTGCGGACAGCTCGGCGTCGACAGCAGCAGCAGTTGCTCAT
TCAGCAGCAGCAACAGCAGCAGCAACAACAACCACAACAAAACCACATGTCATAGGCGCTCGAAGGAAAG
CTAGCAGGTCAATCATCCGCCAGTCACAAATTTGGAACCCGTGCTCCGGAATCCCAGCACACAGAAAAAG
GGAAAGAAAACACCAGTAATGACACCCGTCACAAAGCTGTGAACACATGGTGTATCCATTCGTTACCAAG
GCAATTCAGTATCTTCCTCCTCTGGGCACCAGCCCCCCATTCATTGCTTTTTTACCTACTCAGACCTTTT
CCATCCATGTCAGTGGAAACTCGCAGTGTATTGAGGGAGTGAAGTATTCCAGTCTGCAGACTGAAACAGT
GTAAGAATAAAGTCCGTGACTTTTGAACAAATCACCTGGGCTAGGATTAAGTGAATCTTTGGTCTAAGGC
TCCTCCGGAGATTAGCAAACCCTTCAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 82856. Forward Primer - name:082856_F_cDNA_Lin7a, sequence:AAAGCTGTGGAACTTCTCAAGG; Reverse Primer - name:082856_N_SP6_cDNA_Lin7a, sequence:ATGAAGGGTTTGCTAATCTCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11969 same embryo
 EMAGE:11970 same embryo
 EMAGE:11974 same embryo
 EMAGE:11972 same embryo
 EMAGE:11973 same embryo
 EurExpress:euxassay_011082 same experiment
 MGI:4825931 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS