Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12606

4833439L19Rik RIKEN cDNA 4833439L19 gene ( MGI:1921162)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12606 EMAGE:12606 EMAGE:12606 EMAGE:12606 EMAGE:12606
"Pseudo-wholemount" of euxassay_011470. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011470_01 euxassay_011470_02 euxassay_011470_03 euxassay_011470_04
EMAGE:12606 EMAGE:12606 EMAGE:12606 EMAGE:12606 EMAGE:12606
euxassay_011470_05 euxassay_011470_06 euxassay_011470_07 euxassay_011470_08 euxassay_011470_09
EMAGE:12606 EMAGE:12606 EMAGE:12606 EMAGE:12606 EMAGE:12606
euxassay_011470_10 euxassay_011470_11 euxassay_011470_12 euxassay_011470_13 euxassay_011470_14
EMAGE:12606 EMAGE:12606 EMAGE:12606 EMAGE:12606 EMAGE:12606
euxassay_011470_15 euxassay_011470_16 euxassay_011470_17 euxassay_011470_18 euxassay_011470_19
EMAGE:12606 EMAGE:12606 EMAGE:12606 EMAGE:12606 EMAGE:12606
euxassay_011470_20 euxassay_011470_21 euxassay_011470_22 euxassay_011470_23 euxassay_011470_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12606Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12606_wholemount_strong.wlz
12606_wholemount_moderate.wlz
12606_wholemount_weak.wlz
12606_wholemount_possible.wlz
12606_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12606_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
vibrissa
moderate moderate
regionalmoderate expression: see section 01 17 18 weak expression: see section 02 03 04 19
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 16 17 18 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 17 18
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 12 13 14 15 16 17 18
neural retina
moderate moderate
regionalmoderate expression: see section 01 20 21 weak expression: see section 22 23
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 05 06 07 09 10 11 15 weak expression: see section 08 12 13 14 16
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 08 09 13 weak expression: see section 12
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 07 13 weak expression: see section 08 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30336
Entity Detected:4833439L19Rik, RIKEN cDNA 4833439L19 gene ( MGI:1921162)
Sequence:sense strand is shown

>T30336
CCACAGCCCAGCTCAAGTTCTTTCTCTTGGTTAGTCCAGCACACCACTTTGTTCTCTTGGGCCGTATCTG
CTGTGTCACAGGACAAACACTAGGTCTTATACAGCCCCCTTTTTTCCCCCTGAATTTTAACATGACATTA
ATTTAACTTCTAATTCAGTATGATGCTGGTTTCATACTGGCAAATGGTTCCCCACTCTAATTCCATTACT
GAAGATTAAGCCCAGGCAGGGACTTGCTCATTCTAGGCAAGTGCTCTACCACTGAGCGGGAGTCACCCCT
ACTTCCTGGATAGTAGGCTTTTTTAGTTGTGTGTTTTGTTTTGAGACAGTGTCTCACTTTGTAGCTGTGG
CTATCCTGGAACTCAATCAGTAGATGCCCAGAGATGATGTGCCTGCCTCTGCCGTCCAATGCTGGGATTG
AAGGTGTGCACAGCCACACCAGCTTAAGGTTTTGTTAAAGAAGACGATAGGTATGGCTGGATTATATAGT
CTTCAGGTTCACATGAACTTGGCTGTATTCTGATAACATTGAGACCGTTTTCCACCAAGTTAGCCTCATT
TGTTCAGTAACACATCTTACCGAGGAAAGGAGGCAAGGAAGTGCCCTTTTGTGTCTCCTCATTGTTCACA
GCCTGTTGGTCTCGAACACTCAACATATGATTGCTCGATCACTTTAGATAGTAAGTAGGCTATTTACATA
ATGAGCTAACCTCAGAGAGAAGCCCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4239147), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 33729. Forward Primer - name:033729_F_IRAV81-84_H02_4833439L19Rik, sequence:CCACAGCCCAGCTCAAGT; Reverse Primer - name:033729_R_SP6_IRAV81-84_H02_4833439L19Rik, sequence:CCAGGGCTTCTCTCTGAGG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12605 same embryo
 EMAGE:12607 same embryo
 EurExpress:euxassay_011470 same experiment
 MGI:4822714 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS