Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12648

Wdr36 WD repeat domain 36 ( MGI:1917819)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12648 EMAGE:12648 EMAGE:12648 EMAGE:12648 EMAGE:12648
"Pseudo-wholemount" of euxassay_011586. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011586_01 euxassay_011586_02 euxassay_011586_03 euxassay_011586_04
EMAGE:12648 EMAGE:12648 EMAGE:12648 EMAGE:12648 EMAGE:12648
euxassay_011586_05 euxassay_011586_06 euxassay_011586_07 euxassay_011586_08 euxassay_011586_09
EMAGE:12648 EMAGE:12648 EMAGE:12648 EMAGE:12648 EMAGE:12648
euxassay_011586_10 euxassay_011586_11 euxassay_011586_12 euxassay_011586_13 euxassay_011586_14
EMAGE:12648 EMAGE:12648 EMAGE:12648 EMAGE:12648 EMAGE:12648
euxassay_011586_15 euxassay_011586_16 euxassay_011586_17 euxassay_011586_18 euxassay_011586_19
EMAGE:12648 EMAGE:12648 EMAGE:12648 EMAGE:12648 EMAGE:12648
euxassay_011586_20 euxassay_011586_21 euxassay_011586_22 euxassay_011586_23 euxassay_011586_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12648Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12648_wholemount_strong.wlz
12648_wholemount_moderate.wlz
12648_wholemount_weak.wlz
12648_wholemount_possible.wlz
12648_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12648_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 17 18 19
pancreas
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17
midgut
moderate moderate
regionalmoderate expression: see section 09 10 11 14 15 16 17 18 19 20 weak expression: see section 12 13
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22 23 24 weak expression: see section 12
metanephros
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 17 18 19 20 21
seminiferous cord
moderate moderate
regionalmoderate expression: see section 06 07 08 09 19 20 21 22
left lung
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 13 weak expression: see section 12
right lung
moderate moderate
regionalmoderate expression: see section 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31037
Entity Detected:Wdr36, WD repeat domain 36 ( MGI:1917819)
Sequence:sense strand is shown

>T31037
ATGGCCGCTGGTTGATAAGCGCTGCGATGGATTGCTCTGTTAGGACTTGGGACCTTCCTTCTGGGTGCCT
TATCGACTGCTTTTTGTTGGACTCAGCGCCTCTAAATGTTACTATGTCCCCAACTGGAGACTTTCTAGCA
ACTTCCCATGTGGATCACCTTGGAATTTATCTATGGTCGAATATTTCCCTCTATTCAGTTGTCTCCCTGC
GACCACTTCCTCCAGATTATGTCCCTTCCATAGTGATGCTTCCTGGTACTTGTCAAACCCAAGGTATGGA
AGACTTGGAAGAAAAGACTGAGCCAAGTGATGAAATGATAGAGTATGAGTCGCCAGAACAGTTGAGTGAG
CAACTGGTGACTCTCTCCCTTCTCCCTGAGTCACGCTGGAAAAACCTTCTGAATCTTGATGTTATCAAGA
AAAAGAATAAACCCAAAGAGCCGCCCAAGGTTCCCCAGTCAGCTCCGTTTTTCATCCCAACAGTTCCTGG
GCTTGTCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5346181), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 62799. Forward Primer - name:062799_F_IRAV36-39_H14_5730444A13Rik, sequence:ATGGCCGCTGGTTGATAA; Reverse Primer - name:062799_R_SP6_IRAV36-39_H14_5730444A13Rik, sequence:GGGACAAGCCCAGGAACT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12649 same embryo
 EMAGE:12647 same embryo
 EMAGE:12644 same embryo
 EMAGE:12646 same embryo
 EMAGE:12645 same embryo
 EurExpress:euxassay_011586 same experiment
 MGI:4829197 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS