Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12902

4931406H21Rik RIKEN cDNA 4931406H21 gene ( MGI:1924842)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12902 EMAGE:12902 EMAGE:12902 EMAGE:12902 EMAGE:12902
"Pseudo-wholemount" of euxassay_013607. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013607_01 euxassay_013607_02 euxassay_013607_03 euxassay_013607_04
EMAGE:12902 EMAGE:12902 EMAGE:12902 EMAGE:12902 EMAGE:12902
euxassay_013607_05 euxassay_013607_06 euxassay_013607_07 euxassay_013607_08 euxassay_013607_09
EMAGE:12902 EMAGE:12902 EMAGE:12902 EMAGE:12902 EMAGE:12902
euxassay_013607_10 euxassay_013607_11 euxassay_013607_12 euxassay_013607_13 euxassay_013607_14
EMAGE:12902 EMAGE:12902 EMAGE:12902 EMAGE:12902 EMAGE:12902
euxassay_013607_15 euxassay_013607_16 euxassay_013607_17 euxassay_013607_18 euxassay_013607_19
EMAGE:12902 EMAGE:12902 EMAGE:12902 EMAGE:12902
euxassay_013607_20 euxassay_013607_21 euxassay_013607_22 euxassay_013607_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12902Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12902_wholemount_strong.wlz
12902_wholemount_moderate.wlz
12902_wholemount_weak.wlz
12902_wholemount_possible.wlz
12902_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12902_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
olfactory cortex ventricular layer
weak weak
homogeneousweak expression: see section 12 13 14 18 19
telencephalon ventricular layer
weak weak
homogeneousweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 16 17 18 19 20 21 22 23
rest of cerebellum marginal layer
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 16 17 18 19 20 21 22 23
midbrain ventricular layer
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16 17 18
lower jaw incisor
weak weak
regionalweak expression: see section 13 14 18 19
lower jaw molar
weak weak
regionalweak expression: see section 09 10 20 21
upper jaw incisor
weak weak
regionalweak expression: see section 13 14 18 19
upper jaw molar
weak weak
regionalweak expression: see section 09 10 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37394
Entity Detected:4931406H21Rik, RIKEN cDNA 4931406H21 gene ( MGI:1924842)
Sequence:sense strand is shown

>T37394
GAGCTCATTGGAGTTGTTAGGGGTGTTCAGAACAGAAGCAACTCCTAGGCGGCTCAGCTGTTTCTCTATA
CAGGCAGCTTGCAATAGTGCCCCAAGAGCCAGAGGGGACAGGCCTCTTCTTGTCAGAAGGCCATTCTTCC
TGCCTCTCACAGAATTAGCTCATCTCTCCCCGCCCTACGAGAGAGACTTGTGCAAGGCCAGGGCTGCCTG
GGGCTCAGCCAGGTGTCTACTTTCTAAGCCCATCCAAACCAAGAGGCTGAAGGGGATAGGGAGGGGATGA
GGGCATCCACCCACGGTAGGAGGTGTCTACATCTGCAGCTGTGACCCTACCAGATGATGCAGGGCTTGAG
CTTTCTGCATAGAAGTCCAGGCACTGGCGCCTGCGAGTAGAGGGGAAGGGATCCAGGATGTGTGTGGTGG
GGGAGGTCAAGGCTCCAGCTAAACTGTAGAGAAGTAGGAGCATGGGTGAGAGGGAGAGACCGCAGCGAAG
TGTGGCTGTTAGGCATGGTATGTGCCATGGGCTCCTGGGGCTCAGCCTGCCTGCGGCTCTGTTACTCACC
CCCTCACTCTCACCAGTGAGGAGCCACAGAAGAAGTACTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 68407. Forward Primer - name:068407_F_cDNA_4931406H21Rik, sequence:GAGCTCATTGGAGTTGTTAGGG; Reverse Primer - name:068407_N_SP6_cDNA_4931406H21Rik, sequence:AAGTACTTCTTCTGTGGCTCCTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4822745 same experiment
 EurExpress:euxassay_013607 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS