Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12943

Spats2l spermatogenesis associated, serine-rich 2-like ( MGI:1914448)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12943 EMAGE:12943 EMAGE:12943 EMAGE:12943 EMAGE:12943
"Pseudo-wholemount" of euxassay_013635. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013635_01 euxassay_013635_02 euxassay_013635_03 euxassay_013635_04
EMAGE:12943 EMAGE:12943 EMAGE:12943 EMAGE:12943 EMAGE:12943
euxassay_013635_05 euxassay_013635_06 euxassay_013635_07 euxassay_013635_08 euxassay_013635_09
EMAGE:12943 EMAGE:12943 EMAGE:12943 EMAGE:12943 EMAGE:12943
euxassay_013635_10 euxassay_013635_11 euxassay_013635_12 euxassay_013635_13 euxassay_013635_14
EMAGE:12943 EMAGE:12943 EMAGE:12943 EMAGE:12943 EMAGE:12943
euxassay_013635_15 euxassay_013635_16 euxassay_013635_17 euxassay_013635_18 euxassay_013635_19
EMAGE:12943 EMAGE:12943 EMAGE:12943 EMAGE:12943
euxassay_013635_20 euxassay_013635_21 euxassay_013635_22 euxassay_013635_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12943Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12943_wholemount_strong.wlz
12943_wholemount_moderate.wlz
12943_wholemount_weak.wlz
12943_wholemount_possible.wlz
12943_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12943_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hand mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02
hindlimb digit 1 mesenchyme
weak weak
regionalweak expression: see section 04
hindlimb digit 2 mesenchyme
weak weak
regionalweak expression: see section 04
hindlimb digit 3 mesenchyme
weak weak
regionalweak expression: see section 04
hindlimb digit 4 mesenchyme
weak weak
regionalweak expression: see section 04
hindlimb digit 5 mesenchyme
weak weak
regionalweak expression: see section 04
foot mesenchyme
weak weak
regionalweak expression: see section 05 06
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 05 06 07 weak expression: see section 04 08 09 10 11 17 18 19 20 21 22
vibrissa
weak weak
regionalweak expression: see section 07 08 09 21 22
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 08 10 11 12 13 14 15 16 17 18
telencephalon mantle layer
weak weak
regionalweak expression: see section 10 11 12 15 16 17 18
pons mantle layer
weak weak
regionalweak expression: see section 07 08 10 11 12 13 16 17 18 19
midbrain mantle layer
weak weak
regionalweak expression: see section 07 08 10 11 12 13 15 16 18 19
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 03 weak expression: see section 04 23
esophagus
weak weak
regionalweak expression: see section 14
tongue
weak weak
regionalweak expression: see section 12 13 14 15 16 17
bladder
moderate moderate
regionalmoderate expression: see section 14 15 16 17
genital tubercle of male
moderate moderate
regionalmoderate expression: see section 14 17 18
exoccipital bone
moderate moderate
regionalmoderate expression: see section 01 02 03 weak expression: see section 04 05 06 07 22 23
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 02 03 weak expression: see section 04 05 06 07 13 16 17 18 19 20 22 23
viscerocranium
weak weak
regionalExpression in the turbinate bone.
tail mesenchyme
weak weak
regionalweak expression: see section 13 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T32011
Entity Detected:Spats2l, spermatogenesis associated, serine-rich 2-like ( MGI:1914448)
Sequence:sense strand is shown

>T32011
AGATGGGAACCCCAGAGCGATTCATGGACCATCAGAGAGGTCAGATGGCCCACAGTGGTCAGCTGGGCAG
CCTTGTAACCCAAGCAAGCCTAAGGCAAAAACATCTCCTGTTAAGTCCAATGCCCCTGCAGCTCATCTTG
AAATAAAGCCAGATGAGCTGGCAAAGAAAAGAGGCCCAAATATTGAGAAATCGGTGAAGGATCTGCAGCG
CTGCACTGTTTCTCTGACGAGATACCGCGTCATGATCAAGGAAGAAGTGGACAGTTCCGTGAAGAAGATC
AAAGCAGCATTTGCTGAGCTACACAACTGCATCATTGACAAAGAAGTTTCACTGATGGCAGAAATGGACA
AAGTTAAAGAAGAAGCCATGGACATCCTGACTGCCCGTCAGAAGAAAGCAGAGGAGCTGAAGAGACTGAC
TGACCTAGCCAGTCAGATGGCAGAGATGCAGCTGGCCGAACTCAGAGCTGAAATTAAGCACTTTGTCAGC
GAACGCAAGTATGACGAGGAGCTGGGGAAGGCTGCCCGCTTCTCCTGTGACATTGAACAACTGAAAGCCC
AAATCCTGATCTGTGGAGAAATTACACATCCAAAGAACAGCTACTCCTCAAGAACTCCCTGCAGCTCCCT
GCTGCCTCTGCTGAACACTCATGCGGTAGCTTCCGGGAAACAGGGGAATTTTGCCCGGAAGTCATCCGGT
CACAACAAGCCCTCTGAGGGGAAAGCAGCAAACCCCAAAATGGTGAGCGGACTTGCCAACACTGCCGATG
CGTGTCACCAGACCATGCCCACTAACAAGCAGCAGAATGGACCTTCCAGCCAAAGACGAAGATTTAATCC
ACAGTATCACAACAGGCTAAATGGTCCAGCCAAGTCACAGGGTGGTGGTAATGAAGCGGATCCCATGGCG
AAGAGCAACAGCCGCCATGAACACAGAAGACAGCCACATAATGGTTTCCGTCCCAAAAACAAAGGTGGTG
CCAAAAACC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4216816), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 22981. Forward Primer - name:022981_F_IRAV32-35_L07_2810022L02Rik, sequence:AGATGGGAACCCCAGAGC; Reverse Primer - name:022981_R_SP6_IRAV32-35_L07_2810022L02Rik, sequence:TGGTTTTTGGCACCACCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12944 same embryo
 EurExpress:euxassay_013635 same experiment
 MGI:4828402 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS