EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13590

Mir449a microRNA 449a ( MGI:3619407)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_019192. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_019192_01	euxassay_019192_02	euxassay_019192_03	euxassay_019192_04

euxassay_019192_05	euxassay_019192_06	euxassay_019192_07	euxassay_019192_08	euxassay_019192_09

euxassay_019192_10	euxassay_019192_11	euxassay_019192_12	euxassay_019192_13	euxassay_019192_14

euxassay_019192_15	euxassay_019192_16	euxassay_019192_17	euxassay_019192_18	euxassay_019192_19

euxassay_019192_20	euxassay_019192_21	euxassay_019192_22	euxassay_019192_23	euxassay_019192_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

	strong
	moderate
	weak
	possible
	not detected

wholemount mapping

Download individual expression domains:

13590_wholemount_strong.wlz

13590_wholemount_moderate.wlz

13590_wholemount_weak.wlz

13590_wholemount_possible.wlz

13590_wholemount_not_detected.wlz

(what is wlz format?)

Download all expression domains:

EMAGE:13590_all_domains.zip

Find spatially similar wholemount expression patterns:

EMAGE spatially similar wholemount patterns

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

lateral ventricle choroid plexus

strong

regional

strong expression: see section 05 06 07 08 09 10 12 13 14 15 16 17 18 weak expression: see section 11

telencephalon mantle layer

moderate

regional

moderate expression: see section 19 weak expression: see section 04 05 07 08 09 14 15 16

metencephalon part of 4th ventricle choroid plexus

strong

regional

strong expression: see section 05 06 07 08 09 10 13 14 15 16 17 18 19 20 21 moderate expression: see section 03 04 11 weak expression: see section 12

nasal cavity olfactory epithelium

moderate

regional

moderate expression: see section 09 weak expression: see section 10 11 16 17 18

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T70025
Entity Detected:	Mir449a, microRNA 449a ( MGI:3619407)
Sequence:	sense strand is shown >T70025 TGGCAGTGTATTGTTAGCTGGT
Notes:	The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-449a was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:	LNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:13591 same embryo
	EMAGE:13592 same embryo
	EMAGE:13593 same embryo
	EurExpress:euxassay_019192 same experiment
	MGI:4826286 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source