Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13688

Mir194-2 microRNA 194-2 ( MGI:3618738)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13688 EMAGE:13688 EMAGE:13688 EMAGE:13688 EMAGE:13688
"Pseudo-wholemount" of euxassay_019238. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019238_01 euxassay_019238_02 euxassay_019238_03 euxassay_019238_04
EMAGE:13688 EMAGE:13688 EMAGE:13688 EMAGE:13688 EMAGE:13688
euxassay_019238_05 euxassay_019238_06 euxassay_019238_07 euxassay_019238_08 euxassay_019238_09
EMAGE:13688 EMAGE:13688 EMAGE:13688 EMAGE:13688 EMAGE:13688
euxassay_019238_10 euxassay_019238_11 euxassay_019238_12 euxassay_019238_13 euxassay_019238_14
EMAGE:13688 EMAGE:13688 EMAGE:13688 EMAGE:13688 EMAGE:13688
euxassay_019238_15 euxassay_019238_16 euxassay_019238_17 euxassay_019238_18 euxassay_019238_19
EMAGE:13688 EMAGE:13688 EMAGE:13688 EMAGE:13688 EMAGE:13688
euxassay_019238_20 euxassay_019238_21 euxassay_019238_22 euxassay_019238_23 euxassay_019238_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13688Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13688_wholemount_strong.wlz
13688_wholemount_moderate.wlz
13688_wholemount_weak.wlz
13688_wholemount_possible.wlz
13688_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13688_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 17 18 19 20 21 22 23 24
tongue muscle
moderate moderate
regionalmoderate expression: see section 17 18 19 weak expression: see section 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70309
Entity Detected:Mir194-2, microRNA 194-2 ( MGI:3618738)
Sequence:sense strand is shown

>T70309
TGTAACAGCAACTCCATGTGGA
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-194 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13689 same assay
 EMAGE:13686 same embryo
 EMAGE:13685 same embryo
 EurExpress:euxassay_019238 same experiment
 MGI:4826232 same experiment
 MGI:4826233 same experiment
 EMAGE:13687 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS