EMAGE mouse gene expression spatial database

EMAGE:14140

Nme4 non-metastatic cells 4, protein expressed in ( MGI:1931148)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_001823. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_001823_01	euxassay_001823_02	euxassay_001823_03	euxassay_001823_04

euxassay_001823_05	euxassay_001823_06	euxassay_001823_07	euxassay_001823_08	euxassay_001823_09

euxassay_001823_10	euxassay_001823_11	euxassay_001823_12	euxassay_001823_13	euxassay_001823_14

euxassay_001823_15	euxassay_001823_16	euxassay_001823_17	euxassay_001823_18	euxassay_001823_19

euxassay_001823_20	euxassay_001823_21	euxassay_001823_22

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T6276
Entity Detected:	Nme4, non-metastatic cells 4, protein expressed in ( MGI:1931148)
Sequence:	sense strand is shown >T6276 CTTTTATACGTGTGGTGTTAACGCTTTGAGAGGCGGGGGCTTCAAGCTCGTGGGGATGAAGATGCTGCAG GCACCAGAAAGCATCCTTGCTGAGCACTACCGGGACCTACAGAGGAAGCCATTCTACCCACCTCTTATCA GCTACATGAGCTCTGGGCCTGTGGTGGCCATGGTCTGGGAAGGCCCCAATGTGGTCCATATCTCAAGGGC CATGATAGGACACACCGACTCAACAGAGGCAGCCCCCGGGACAATCAGGGGCGACTTCAGTGTTCACATC AGCAGGAACGTCATCCATGCTAGCGATTCTGTGGATGGGGCCCAGAGGGAGATCGAGCTGTGGTTTCAGA GCAGCGAACTGTTGAACTGGGCAGATGGTGGTCACCACAGCAGCTGCTACCCTGCCTGAGGGCTTGCACT GCCTTCTGCACTTCAGGTCTACCCATGACCTACTACCTCTGTCAACAAGAAGTCAAGCCCCCATGCTTCC CATGTCCCCAAACCACTCCCTACTCCCGCTCTACCCAACTCCAGCCCAGGGGAGTCTAAGCCTCAACTCT ATGTGCCTTTTTGTATCCTAAGTCAATACAATATTGGACCATGTCCTTGTGTACAAAAGTGCCAGACAAC CTTTGGGGCATTGTCAAAGGTGACTTCACCTGCCTCAAAGGAGAGACATTAAACTATAGTGTCACGTCAA CACAACAACAACATAA
Notes:	The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:AGATGGGGTACAGAGGAGAC; Reverse Primer - name:unspecified, sequence:TTTAATGTCTCTCCTTTGAGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:14138 same embryo
	EMAGE:14141 same embryo
	EMAGE:14137 same embryo
	EMAGE:14139 same embryo
	EurExpress:euxassay_001823 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source