Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15010

Eppk1 epiplakin 1 ( MGI:2386306)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15010 EMAGE:15010 EMAGE:15010 EMAGE:15010 EMAGE:15010
"Pseudo-wholemount" of euxassay_008063. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008063_01 euxassay_008063_02 euxassay_008063_03 euxassay_008063_04
EMAGE:15010 EMAGE:15010 EMAGE:15010 EMAGE:15010 EMAGE:15010
euxassay_008063_05 euxassay_008063_06 euxassay_008063_07 euxassay_008063_08 euxassay_008063_09
EMAGE:15010 EMAGE:15010 EMAGE:15010 EMAGE:15010 EMAGE:15010
euxassay_008063_10 euxassay_008063_11 euxassay_008063_12 euxassay_008063_13 euxassay_008063_14
EMAGE:15010 EMAGE:15010 EMAGE:15010 EMAGE:15010 EMAGE:15010
euxassay_008063_15 euxassay_008063_16 euxassay_008063_17 euxassay_008063_18 euxassay_008063_19
EMAGE:15010 EMAGE:15010 EMAGE:15010
euxassay_008063_20 euxassay_008063_21 euxassay_008063_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15010Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15010_wholemount_strong.wlz
15010_wholemount_moderate.wlz
15010_wholemount_weak.wlz
15010_wholemount_possible.wlz
15010_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15010_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
strong strong
regionalstrong expression: see section 06 07 08 09 15 16 17
pancreas
moderate moderate
regionalmoderate expression: see section 09 13 14 weak expression: see section 10 11
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
vibrissa
strong strong
regionalstrong expression: see section 07 08 09 10 11
naris
strong strong
regionalstrong expression: see section 16 17 19 20 moderate expression: see section 15
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 18 moderate expression: see section 11 12 13 14 15 19 20
nasal cavity respiratory epithelium
strong strong
regionalstrong expression: see section 16 18 moderate expression: see section 15
heart ventricle
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16
esophagus
strong strong
regionalstrong expression: see section 08 09 10
stomach
strong strong
regionalstrong expression: see section 01 02 03 04 05 moderate expression: see section 09 10 weak expression: see section 07 08
midgut
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19 20 21 22
lower jaw incisor
strong strong
regionalstrong expression: see section 12 13 14 15 16
oral epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
upper jaw incisor
strong strong
regionalstrong expression: see section 14 15
upper jaw molar
strong strong
regionalstrong expression: see section 08 20
urethra of male
moderate moderate
regionalmoderate expression: see section 13 14 15
larynx
strong strong
regionalstrong expression: see section 09 10 11
left lung
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10
right lung
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 19 not examined expression: see section 10
trachea
strong strong
regionalstrong expression: see section 09 moderate expression: see section 10
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36349
Entity Detected:Eppk1, epiplakin 1 ( MGI:2386306)
Sequence:sense strand is shown

>T36349
CAGCAAGTTTCTGTGTGGAAAGTCCTGTTCTCCTCCTACCTGAGTGAGACCCGCCGGGAGGAGCTCCTTG
CCCAGCACTTGGCTGGCAAGCTGGGGGTAATGGAACTCGTTTCCCTCCTCACCCAAATCATCGAGGAGAC
AGAAGAACGGCTCAGCAAGGTGTCTTTCCCCGGCCTGAGGCGACAGGTGTCCGCATCTGAGTTGTGTACC
TCTGGCATCCTGGACCGGGACACCATGCGAGAACTGGCACAGGGCACCAAGACCATTCATGAGGTGACAG
AGATGGACTCCGTCAAGCGCTACCTGGGGGGCTCCAGCTGCATAGCGGGCGTCCTGGTGCCCGTCCAGGG
AGAGCCTGGGCGCCAGGAGAAGATGAGCATCTATCAGGCCATGTGGAAGGGAGTCCTGAGGCCAGGCACA
GCCCTGGTGCTGCTGGAGGCTCAGGCAGCCACAGGCTTCATCATCGACCCAGTGAACAACCGCAGACTGT
CTGTGGAGGAGGCCGTGGCTGCAGGCGTGGTGGGAGGCGAGATCCAAGAGAAGCTGCTGTCTGCTGAGCG
TGCGGTCACCGGGTACACGGACCCCTACACCGGGGACCAGATCTCCCTCTTCCAGGCCATGCAGAGGGAC
CTCATTGTTAAGAACCATGGTATTCGACTGCTGGAAGCCCAGATTGCCACAGGTGGCGTCATCGATCCTG
TGCACAGCCACCGTGTGCCCGTGGACGTGGCCTACCAGCGTGGCTACTTTGATCAAGAGATGAACAGCAT
TTTGGCAGACCCTGGTGACGACACCAAGGGCTTCTTTGATCCCAACACTCATGAGAACCTCACTTACCTA
CAGCTTCTGCAGAGAGCTACAATTGACCCTGAGACGGGATTATT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 72467. Forward Primer - name:072467_F_cDNA_Eppk1, sequence:CAGCAAGTTTCTGTGTGGAAAG; Reverse Primer - name:072467_N_SP6_cDNA_Eppk1, sequence:AATAATCCCGTCTCAGGGTCA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15012 same embryo
 EMAGE:15011 same embryo
 EMAGE:15008 same embryo
 EMAGE:15009 same embryo
 EurExpress:euxassay_008063 same experiment
 MGI:4824599 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS