EMAGE mouse gene expression spatial database

EMAGE:15163

Cox6b1 cytochrome c oxidase, subunit VIb polypeptide 1 ( MGI:107460)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_010415. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_010415_01	euxassay_010415_02	euxassay_010415_03	euxassay_010415_04

euxassay_010415_05	euxassay_010415_06	euxassay_010415_07	euxassay_010415_08	euxassay_010415_09

euxassay_010415_10	euxassay_010415_11	euxassay_010415_12	euxassay_010415_13	euxassay_010415_14

euxassay_010415_15	euxassay_010415_16	euxassay_010415_17	euxassay_010415_18	euxassay_010415_19

euxassay_010415_20	euxassay_010415_21

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T30267
Entity Detected:	Cox6b1, cytochrome c oxidase, subunit VIb polypeptide 1 ( MGI:107460)
Sequence:	sense strand is shown >T30267 AACGCTACTCCGGGACAATCTTTAGGAGTCAGGATGGCTGAAGACATCAAGACTAAAATCAAGAACTACA AAACTGCCCCCTTTGACAGCCGCTTCCCCAACCAGAACCAGACTAAGAACTGTTGGCAGAACTACCTGGA CTTCCACCGCTGTGAGAAGGCAATGACGGCCAAGGGGGGTGATGTCTCCGTGTGTGAGTGGTACCGGCGT GTGTACAAGTCCCTCTGTCCCGTGTCATGGGTCTCAGCCTGGGATGACCGCATAGCTGAAGGCACATTTC CTGGGAAGATCTGACCTGGCTCCGCCCACCTCTCCTCTGTTCTTTGTCTTTCTCCCCGGATAGAAAAGGG GGACCTCAG
Notes:	The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4989436), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 27665. Forward Primer - name:027665_F_IRAV71-74_B23_Cox6b, sequence:AACGCTACTCCGGGACAA; Reverse Primer - name:027665_R_SP6_IRAV71-74_B23_Cox6b, sequence:GCTGAGGTCCCCCTTTTC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:15162 same embryo
	EMAGE:15166 same embryo
	EMAGE:15167 same embryo
	EMAGE:15165 same embryo
	EMAGE:15164 same embryo
	EurExpress:euxassay_010415 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source