Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15321

Slc16a10 solute carrier family 16 (monocarboxylic acid transporters), member 10 ( MGI:1919722)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15321 EMAGE:15321 EMAGE:15321 EMAGE:15321 EMAGE:15321
"Pseudo-wholemount" of euxassay_010493. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010493_01 euxassay_010493_02 euxassay_010493_03 euxassay_010493_04
EMAGE:15321 EMAGE:15321 EMAGE:15321 EMAGE:15321 EMAGE:15321
euxassay_010493_05 euxassay_010493_06 euxassay_010493_07 euxassay_010493_08 euxassay_010493_09
EMAGE:15321 EMAGE:15321 EMAGE:15321 EMAGE:15321 EMAGE:15321
euxassay_010493_10 euxassay_010493_11 euxassay_010493_12 euxassay_010493_13 euxassay_010493_14
EMAGE:15321 EMAGE:15321 EMAGE:15321 EMAGE:15321 EMAGE:15321
euxassay_010493_15 euxassay_010493_16 euxassay_010493_17 euxassay_010493_18 euxassay_010493_19
EMAGE:15321 EMAGE:15321 EMAGE:15321
euxassay_010493_20 euxassay_010493_21 euxassay_010493_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
vibrissa
weak weak
regionalweak expression: see section 04 05 19
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 10 11 12 14 15 16 17 18 moderate expression: see section 07 08 weak expression: see section 09 13
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
liver lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30483
Entity Detected:Slc16a10, solute carrier family 16 (monocarboxylic acid transporters), member 10 ( MGI:1919722)
Sequence:sense strand is shown

>T30483
ATGGCCTTCAAGACAGCGTGGGTGGGCTCGCTGTCCATGGGCATGATCTTCTTCTGCTGCCCCATCGTGA
GTGTCTTCACGGACATGTTCGGCTGCCGGAGAACAGCTGTTGTGGGGGCAGCTGTGGGATTCATTGGACT
CATGTCCAGTTCTTTTGTAAGCTCCATCGAGCCTCTGTACCTCACCTATGGAATCATATTTGCCTGCGGC
TGCTCCTTTGCCTACCAGCCGTCACTGGTCATTTTGGGACACTACTTCAAGAAGCGCCTTGGACTAGTCA
ACGGCATCGTCACGGCCGGCAGCAGCGTCTTCACAATCCTGCTCCCTTTGCTGTTAGGAAATCTAATCAG
CAGTGTGAAGCTCTTTAACACGCTGCGGATCCTCTGCATCTTCATGTTTGTTCTCTTTCTGGCTGGCTTT
ACCTACCGACCTCTTGTTCCCAGCACCAAAGAGAAAGAGAGTGGGGGCAGCAGAAGCTCATTCTTCTCCA
GGAGAAAGCTTAGTCCTCCAAAAAAAGTCTTTAACTTTGCCCTCTTCAAGGAGACAACCTATGCAGTGTG
GGCTGCTGGGATA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:30046388), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58906. Forward Primer - name:058906_F_IRAV107_g05_Slc16a10, sequence:ATGGCCTTCAAGACAGCG; Reverse Primer - name:058906_R_SP6_IRAV107_g05_Slc16a10, sequence:GTATCCCAGCAGCCCACA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15322 same embryo
 EMAGE:15318 same embryo
 EMAGE:15320 same embryo
 EMAGE:15319 same embryo
 EMAGE:15317 same embryo
 EurExpress:euxassay_010493 same experiment
 MGI:4828107 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS