Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15538

D14Ertd449e DNA segment, Chr 14, ERATO Doi 449, expressed ( MGI:1196450)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15538 EMAGE:15538 EMAGE:15538 EMAGE:15538 EMAGE:15538
"Pseudo-wholemount" of euxassay_010761. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010761_01 euxassay_010761_02 euxassay_010761_03 euxassay_010761_04
EMAGE:15538 EMAGE:15538 EMAGE:15538 EMAGE:15538 EMAGE:15538
euxassay_010761_05 euxassay_010761_06 euxassay_010761_07 euxassay_010761_08 euxassay_010761_09
EMAGE:15538 EMAGE:15538 EMAGE:15538 EMAGE:15538 EMAGE:15538
euxassay_010761_10 euxassay_010761_11 euxassay_010761_12 euxassay_010761_13 euxassay_010761_14
EMAGE:15538 EMAGE:15538 EMAGE:15538 EMAGE:15538 EMAGE:15538
euxassay_010761_15 euxassay_010761_16 euxassay_010761_17 euxassay_010761_18 euxassay_010761_19
EMAGE:15538
euxassay_010761_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15538Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15538_wholemount_strong.wlz
15538_wholemount_moderate.wlz
15538_wholemount_weak.wlz
15538_wholemount_possible.wlz
15538_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15538_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 09 10 11 12 13
submandibular gland primordium
strong strong
regionalstrong expression: see section 15 16 17 moderate expression: see section 06 07 08
pancreas
moderate moderate
regionalmoderate expression: see section 07 08 09
thyroid gland
moderate moderate
regionalmoderate expression: see section 09 13 14 weak expression: see section 10
vibrissa
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 19 20
lateral ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 16 17 18
medulla oblongata floor plate
weak weak
regionalweak expression: see section 10 11
metencephalon floor plate
weak weak
regionalweak expression: see section 11
metencephalon part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain floor plate
weak weak
regionalweak expression: see section 11 12
spinal cord floor plate
weak weak
regionalweak expression: see section 09 10
dorsal root ganglion
weak weak
regionalweak expression: see section 05 06 07 12 13 14 15
ear
moderate moderate
regionalmoderate expression: see section 01 02 03 20
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 15 16 17 18
esophagus
moderate moderate
regionalmoderate expression: see section 10 11
stomach
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08
midgut
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 14 15
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 18
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 14 15
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06
bladder
moderate moderate
regionalmoderate expression: see section 13 14
metanephros
weak weak
regionalweak expression: see section 05 06 07 08 14 15 16 17
urethra of male
moderate moderate
regionalmoderate expression: see section 13 14 15
thyroid cartilage
weak weak
regionalweak expression: see section 10 11
lung
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 10 11 12 13 14 15 16 17 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31245
Entity Detected:D14Ertd449e, DNA segment, Chr 14, ERATO Doi 449, expressed ( MGI:1196450)
Sequence:sense strand is shown

>T31245
TCTGGCCTCAGAGCATCCCTTATCAGAGCCTTGGGCCCCTGGGTCCCTTCACGAAGTATTTGGTGGACCA
CTATCACACCTTCCTAAGGAATGGGTATTGGCTTGCTTGGCTAATTCATGTGGGAGAGTCCTTGTATGCC
TTGGTTTTATGCAAGCGTAAAGGAATCACAGACGTCCAGGCCCAGCTCCTCTGGTTCCTACAGACTTTTC
TGTTTGGTGTAGCCTCTCTCTCCATCCTGATTGCTTACAGATCAAAGCGCCAAAAACACAATTAAAAAAG
AGAGAGCAAGTTTCTCTCCACCTCTTCAAGCCCTCCTTTCAGTGGGGCCCTGGGTACCATGATGGCCTCC
CTGTCTTCTAGGCAGTGTCTGTCGAAGAACCTGCCTGAGACCCTCTGGTTACTATTATTTTGGTGCTCTG
ACTAACCTTGGATAGATCTTTCTTGTTTAAGAAAGAAATAAGAAAGACCCTGCCCTTCCAGCTCTGCAGA
CCTCCTGCCTGAAGATGGCCTCAGGCCACTTTCCTGAGGTCCTTAGCTGAGTCATTTTCCTGCCTTTTGG
CTAAAACACACTAGATTTATTTGTGGGTGCACCTATGCTCTGTGTGGTGGTTTGAATATGCTTGGCCCAT
GGGAAGTGGCACTACTAGGAGGTATGTGGCCTTGTTAGAGGAAATGGGTCGCTGTGGAGGCCAGATTTTG
AGGTCTCATATATTTGCTCAAGTCTAGCCAGTGTGAAACGGTCTCCTTCCGCTGCCTTTAGATCAAGATG
TAGAACTCTCAGCTCCTTTTCCGGATCATGTTCGCCTGGACACTGCCATGCTTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4194400), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 55535. Forward Primer - name:055535_F_IRAV49_b04_D14Ertd449e, sequence:TCTGGCCTCAGAGCATCC; Reverse Primer - name:055535_R_SP6_IRAV49_b04_D14Ertd449e, sequence:GGAAGCATGGCAGTGTCC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15539 same embryo
 EMAGE:15540 same embryo
 EurExpress:euxassay_010761 same experiment
 MGI:4824194 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS