Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15554

Gm4881 predicted gene 4881 ( MGI:3642958)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15554 EMAGE:15554 EMAGE:15554 EMAGE:15554 EMAGE:15554
"Pseudo-wholemount" of euxassay_010833. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010833_01 euxassay_010833_02 euxassay_010833_03 euxassay_010833_04
EMAGE:15554 EMAGE:15554 EMAGE:15554 EMAGE:15554 EMAGE:15554
euxassay_010833_05 euxassay_010833_06 euxassay_010833_07 euxassay_010833_08 euxassay_010833_09
EMAGE:15554 EMAGE:15554 EMAGE:15554 EMAGE:15554 EMAGE:15554
euxassay_010833_10 euxassay_010833_11 euxassay_010833_12 euxassay_010833_13 euxassay_010833_14
EMAGE:15554 EMAGE:15554 EMAGE:15554 EMAGE:15554 EMAGE:15554
euxassay_010833_15 euxassay_010833_16 euxassay_010833_17 euxassay_010833_18 euxassay_010833_19
EMAGE:15554 EMAGE:15554 EMAGE:15554
euxassay_010833_20 euxassay_010833_21 euxassay_010833_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15554Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15554_wholemount_strong.wlz
15554_wholemount_moderate.wlz
15554_wholemount_weak.wlz
15554_wholemount_possible.wlz
15554_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15554_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
moderate moderate
single cellmoderate expression: see section 07 09 14 15 16
medulla oblongata basal plate mantle layer
moderate moderate
single cellmoderate expression: see section 07 08 09 14
pons mantle layer
moderate moderate
single cellmoderate expression: see section 06 07 08 09 10 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38364
Entity Detected:Gm4881, predicted gene 4881 ( MGI:3642958)
Sequence:sense strand is shown

>T38364
CTATTCACCCCAGAGACGGATAAACTACGTCTGGACAGCCCCTTCCCATTCCTGGGTTCTGGTGCCACAG
GCTACTCCAAGCCGCCCAGCCTGCTGGGTCCTTACGGCCGCGCCTTCCCTGAGTACCCCTGGAACTTCAA
CCCATACCTCACCGGCCCCTTCCCCAAGTTGCCCCCCTCTCTCTACCCACCTCACTTCTACCCCAACCCT
TTGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 108707. Forward Primer - name:108707_F_cDNA_LOC232974, sequence:CTATTCACCCCAGAGACGGATA; Reverse Primer - name:108707_N_SP6_cDNA_LOC232974, sequence:CCAAAGGGTTGGGGTAGAAGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15556 same embryo
 EMAGE:15552 same embryo
 EMAGE:15553 same embryo
 EMAGE:15555 same embryo
 EMAGE:15557 same embryo
 EurExpress:euxassay_010833 same experiment
 MGI:4825103 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS