Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15603

Trim29 tripartite motif-containing 29 ( MGI:1919419)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15603 EMAGE:15603 EMAGE:15603 EMAGE:15603 EMAGE:15603
"Pseudo-wholemount" of euxassay_010785. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010785_01 euxassay_010785_02 euxassay_010785_03 euxassay_010785_04
EMAGE:15603 EMAGE:15603 EMAGE:15603 EMAGE:15603 EMAGE:15603
euxassay_010785_05 euxassay_010785_06 euxassay_010785_07 euxassay_010785_08 euxassay_010785_09
EMAGE:15603 EMAGE:15603 EMAGE:15603 EMAGE:15603 EMAGE:15603
euxassay_010785_10 euxassay_010785_11 euxassay_010785_12 euxassay_010785_13 euxassay_010785_14
EMAGE:15603 EMAGE:15603 EMAGE:15603 EMAGE:15603 EMAGE:15603
euxassay_010785_15 euxassay_010785_16 euxassay_010785_17 euxassay_010785_18 euxassay_010785_19
EMAGE:15603
euxassay_010785_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15603Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15603_wholemount_strong.wlz
15603_wholemount_moderate.wlz
15603_wholemount_weak.wlz
15603_wholemount_possible.wlz
15603_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15603_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
regionalstrong expression: see section 10 11 12 13
skin
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
vibrissa
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 17 18 19 20
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 03 14 15 16 17 18 moderate expression: see section 04 06 07 08 19 20
cornea epithelium
strong strong
regionalstrong expression: see section 01 02 03 04 20
anterior naris
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 11
external naris
strong strong
regionalstrong expression: see section 11 14
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 14 15 weak expression: see section 08 09
esophagus epithelium
strong strong
regionalstrong expression: see section 10 11
pharynx epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 13 14
stomach
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09
lower jaw incisor
strong strong
regionalstrong expression: see section 10 11 14 15
lower jaw molar
strong strong
regionalstrong expression: see section 06 07 17
oral epithelium
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 14 15 16 17 18
upper jaw incisor
strong strong
regionalstrong expression: see section 11 14 15
upper jaw molar
strong strong
regionalstrong expression: see section 06 07 17
urethra of male
strong strong
regionalstrong expression: see section 10 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38326
Entity Detected:Trim29, tripartite motif-containing 29 ( MGI:1919419)
Sequence:sense strand is shown

>T38326
TTACTCTCTCCCTCCACCTCTGCCCACCTACCATGTCCTGCTGGAGGGAGAGGGGCTGGGACAGTCTCTT
GGCAACTGCAAGGATGACCTGCTCAATGTGTGCATGCGTCATGTTGAGAAGATGTGCAAGGCCGATTTGA
GCCGCAACTTCATTGAGAGGAACCATATGGAAAATGGTGGGGACCATCGCTACATGAACAGCTACACCAG
CAGCTATGGGAACGAGTGGAGCACGCCTGACACCATGAAAAGATACTCCATGTACCTCACGCCCAAGGGT
GGGGGCCGGACATCCTACCAGCCATCCTCGCCTAGCCGCCTCTCCAAGGAGACCAACCAGAAGAATTTTA
ACAATCTGTATGGCACAAAAGGCAACTATACCTCCAGGGTCTGGGAGTACACATCCACGGTTCAGAATTC
TGAGGATATGCCCACGGTGCAAGGCAACTCCTCCTTCTCCCTGAAAGGCTTTCCCTCCCTCCTCCGGAGC
CAAGTTCCCAAGGCCCAGCCTCAGACTTGGAAATCTGGCAAGCAGACTCTGCTGTCTCACTACCGGCCAT
TCTATGTCAACAAGGGCAGCGGCATCGGATCCAACGAGGCGCCCTGAGTTCAGGATGGAGGAAGCTGCAC
TCCCCCATCCTCCTGTTGCTCCTGCTTTGCAAGCTGCTGTTCTTTCTCCCGGGCAGGAGCCCAGCCCCAC
CCTGCCCTCACACAGTCTCTGGCAGCCCTA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 142095. Forward Primer - name:142095_F_cDNA_Trim29, sequence:TTACTCTCTCCCTCCACCTCTG; Reverse Primer - name:142095_N_SP6_cDNA_Trim29, sequence:TAGGGCTGCCAGAGACTGTGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15602 same embryo
 EMAGE:15606 same embryo
 EMAGE:15605 same embryo
 EMAGE:15607 same embryo
 EMAGE:15604 same embryo
 EurExpress:euxassay_010785 same experiment
 MGI:4828912 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS