Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15886

Ankrd13c ankyrin repeat domain 13c ( MGI:2139746)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15886 EMAGE:15886 EMAGE:15886 EMAGE:15886 EMAGE:15886
"Pseudo-wholemount" of euxassay_013346. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013346_01 euxassay_013346_02 euxassay_013346_03 euxassay_013346_04
EMAGE:15886 EMAGE:15886 EMAGE:15886 EMAGE:15886 EMAGE:15886
euxassay_013346_05 euxassay_013346_06 euxassay_013346_07 euxassay_013346_08 euxassay_013346_09
EMAGE:15886 EMAGE:15886 EMAGE:15886 EMAGE:15886 EMAGE:15886
euxassay_013346_10 euxassay_013346_11 euxassay_013346_12 euxassay_013346_13 euxassay_013346_14
EMAGE:15886 EMAGE:15886 EMAGE:15886 EMAGE:15886 EMAGE:15886
euxassay_013346_15 euxassay_013346_16 euxassay_013346_17 euxassay_013346_18 euxassay_013346_19
EMAGE:15886 EMAGE:15886 EMAGE:15886 EMAGE:15886
euxassay_013346_20 euxassay_013346_21 euxassay_013346_22 euxassay_013346_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15886Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15886_wholemount_strong.wlz
15886_wholemount_moderate.wlz
15886_wholemount_weak.wlz
15886_wholemount_possible.wlz
15886_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15886_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
regionalstrong expression: see section 08 09 10 11 12
submandibular gland primordium
strong strong
regionalstrong expression: see section 05 06 07 08 14 15 16
thyroid gland
strong strong
regionalstrong expression: see section 07 08 12
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 17 18
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 15
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 16 17 18 19 20 21
vagus x ganglion
strong strong
regionalstrong expression: see section 05 15
dorsal root ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 11 12 13 14
liver
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39999
Entity Detected:Ankrd13c, ankyrin repeat domain 13c ( MGI:2139746)
Sequence:sense strand is shown

>T39999
AGAAGACAGTCCCTTACCCCTCCTCCTCAGAACACTATTACGTGGGAAGAATACATATCCGCTGAAAATG
GAAAGGCACCACACCTGGGCAGAGAACTGGTGTGCAAAGAGAGCAAGAAAACATTTAAAGCCACTGTAGC
CATGAGCCAGGAATTTCCCCTGGGAATTGAGTCATTGTTGAATGTTCTAGAAGTAATAGCACCCTTCAAG
CACTTTAACAAGCTTAGAGAATTCGTTCAAATGAAGCTTCCTCCAGGCTTTCCTGTAAAATTAGATATAC
CCGTGTTTCCCACAATCACAGCCACTGTGACTTTTCAGGAGTTCCGATGTGATGAATTTGATGGATCCAT
CTTTGCTATCCCTGAAGACTACAAGGAAGACCCAAGTCGTTTTCCTGACCTTTAACTGATCCAGAAGAGC
ATGAGGCTCCAGGTGGCAAAGGCAGAGCTTTTCTAAGCAGAGTGTCAACACATCAGTGATGTGATGAAAA
ACTGACCTCTAATAAAACATCCACAGCTTCCTGATGTGCCATTCATTCATC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 107137. Forward Primer - name:107137_F_cDNA_LOC433667, sequence:AGAAGACAGTCCCTTACCCCTC; Reverse Primer - name:107137_N_SP6_cDNA_LOC433667, sequence:GATGAATGAATGGCACATCAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15887 same embryo
 EMAGE:15888 same embryo
 EurExpress:euxassay_013346 same experiment
 MGI:4823129 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS