EMAGE mouse gene expression spatial database

EMAGE:16417

Mir7-2 microRNA 7-2 ( MGI:3619437)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_019073. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_019073_01	euxassay_019073_02	euxassay_019073_03	euxassay_019073_04

euxassay_019073_05	euxassay_019073_06	euxassay_019073_07	euxassay_019073_08	euxassay_019073_09

euxassay_019073_10	euxassay_019073_11	euxassay_019073_12	euxassay_019073_13	euxassay_019073_14

euxassay_019073_15	euxassay_019073_16	euxassay_019073_17	euxassay_019073_18	euxassay_019073_19

euxassay_019073_20	euxassay_019073_21

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

pituitary gland

weak

regional

weak expression: see section 08 09 10 11 12 13

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T70187
Entity Detected:	Mir7-2, microRNA 7-2 ( MGI:3619437)
Sequence:	sense strand is shown >T70187 TGGAAGACTAGTGATTTTGTTGT
Notes:	The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-7a was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:	LNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:16418 same assay
	EMAGE:16419 same embryo
	EMAGE:16420 same embryo
	EMAGE:16421 same embryo
	EurExpress:euxassay_019073 same experiment
	MGI:4826372 same experiment
	MGI:4826371 same experiment
	EMAGE:16416 same embryo
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source