Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16744

Mir509 microRNA 509 ( MGI:3718545)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16744 EMAGE:16744 EMAGE:16744 EMAGE:16744 EMAGE:16744
"Pseudo-wholemount" of euxassay_019294. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019294_01 euxassay_019294_02 euxassay_019294_03 euxassay_019294_04
EMAGE:16744 EMAGE:16744 EMAGE:16744 EMAGE:16744 EMAGE:16744
euxassay_019294_05 euxassay_019294_06 euxassay_019294_07 euxassay_019294_08 euxassay_019294_09
EMAGE:16744 EMAGE:16744 EMAGE:16744 EMAGE:16744 EMAGE:16744
euxassay_019294_10 euxassay_019294_11 euxassay_019294_12 euxassay_019294_13 euxassay_019294_14
EMAGE:16744 EMAGE:16744 EMAGE:16744 EMAGE:16744 EMAGE:16744
euxassay_019294_15 euxassay_019294_16 euxassay_019294_17 euxassay_019294_18 euxassay_019294_19
EMAGE:16744 EMAGE:16744 EMAGE:16744 EMAGE:16744 EMAGE:16744
euxassay_019294_20 euxassay_019294_21 euxassay_019294_22 euxassay_019294_23 euxassay_019294_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16744Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16744_wholemount_strong.wlz
16744_wholemount_moderate.wlz
16744_wholemount_weak.wlz
16744_wholemount_possible.wlz
16744_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16744_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
humerus
moderate moderate
regionalmoderate expression: see section 02 weak expression: see section 01 21 22 23
fibula
weak weak
regionalweak expression: see section 24
tibia
weak weak
regionalweak expression: see section 24
femur
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 03 04
meckel's cartilage
weak weak
regionalweak expression: see section 08 09 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70078
Entity Detected:Mir509, microRNA 509 ( MGI:3718545)
Sequence:sense strand is shown

>T70078
TACTCCAGAATGTGGCAATCAT
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-509-5p was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16747 same embryo
 EMAGE:16743 same embryo
 EMAGE:16745 same embryo
 EMAGE:16746 same embryo
 EurExpress:euxassay_019294 same experiment
 MGI:4826327 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS