Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16745

Mir532 microRNA 532 ( MGI:3629950)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16745 EMAGE:16745 EMAGE:16745 EMAGE:16745 EMAGE:16745
"Pseudo-wholemount" of euxassay_019296. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019296_01 euxassay_019296_02 euxassay_019296_03 euxassay_019296_04
EMAGE:16745 EMAGE:16745 EMAGE:16745 EMAGE:16745 EMAGE:16745
euxassay_019296_05 euxassay_019296_06 euxassay_019296_07 euxassay_019296_08 euxassay_019296_09
EMAGE:16745 EMAGE:16745 EMAGE:16745 EMAGE:16745 EMAGE:16745
euxassay_019296_10 euxassay_019296_11 euxassay_019296_12 euxassay_019296_13 euxassay_019296_14
EMAGE:16745 EMAGE:16745 EMAGE:16745 EMAGE:16745 EMAGE:16745
euxassay_019296_15 euxassay_019296_16 euxassay_019296_17 euxassay_019296_18 euxassay_019296_19
EMAGE:16745 EMAGE:16745 EMAGE:16745 EMAGE:16745 EMAGE:16745
euxassay_019296_20 euxassay_019296_21 euxassay_019296_22 euxassay_019296_23 euxassay_019296_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16745Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16745_wholemount_strong.wlz
16745_wholemount_moderate.wlz
16745_wholemount_weak.wlz
16745_wholemount_possible.wlz
16745_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16745_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
humerus
weak weak
regionalweak expression: see section 01 02 20 21 22 24
fibula
weak weak
regionalweak expression: see section 24
tibia
weak weak
regionalweak expression: see section 24
femur
moderate moderate
regionalmoderate expression: see section 03 17 18 21 22 weak expression: see section 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70081
Entity Detected:Mir532, microRNA 532 ( MGI:3629950)
Sequence:sense strand is shown

>T70081
CATGCCTTGAGTGTAGGACCGT
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-532-5p was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16747 same embryo
 EMAGE:16744 same embryo
 EMAGE:16743 same embryo
 EMAGE:16746 same embryo
 EurExpress:euxassay_019296 same experiment
 MGI:4826329 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS