Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16840

Mylpf myosin light chain, phosphorylatable, fast skeletal muscle ( MGI:97273)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16840 EMAGE:16840 EMAGE:16840 EMAGE:16840 EMAGE:16840
"Pseudo-wholemount" of euxassay_008765. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008765_01 euxassay_008765_02 euxassay_008765_03 euxassay_008765_04
EMAGE:16840 EMAGE:16840 EMAGE:16840 EMAGE:16840 EMAGE:16840
euxassay_008765_05 euxassay_008765_06 euxassay_008765_07 euxassay_008765_08 euxassay_008765_09
EMAGE:16840 EMAGE:16840 EMAGE:16840 EMAGE:16840 EMAGE:16840
euxassay_008765_10 euxassay_008765_11 euxassay_008765_12 euxassay_008765_13 euxassay_008765_14
EMAGE:16840 EMAGE:16840 EMAGE:16840 EMAGE:16840 EMAGE:16840
euxassay_008765_15 euxassay_008765_16 euxassay_008765_17 euxassay_008765_18 euxassay_008765_19
EMAGE:16840 EMAGE:16840 EMAGE:16840 EMAGE:16840 EMAGE:16840
euxassay_008765_20 euxassay_008765_21 euxassay_008765_22 euxassay_008765_23 euxassay_008765_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16840Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16840_wholemount_strong.wlz
16840_wholemount_moderate.wlz
16840_wholemount_weak.wlz
16840_wholemount_possible.wlz
16840_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16840_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diaphragm
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 16 17 18 19 20 21 22 23 24
arm
strong strong
regionalstrong expression: see section 01 02 not examined expression: see section 22
hand
strong strong
regionalstrong expression: see section 01 02 03 20 21 22
foot
strong strong
regionalstrong expression: see section 06 07 20 21 22
leg
strong strong
regionalstrong expression: see section 01 02 03 04 05
head mesenchyme
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 17 18 19 20 21 22 23 24
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
tongue muscle
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 moderate expression: see section 11
tail mesenchyme
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1261
Entity Detected:Mylpf, myosin light chain, phosphorylatable, fast skeletal muscle ( MGI:97273)
Sequence:sense strand is shown

>T1261
CCTCGAGNCTGTTGGCCTACTGGAGATTCTCTTCCTTTTTCCATCTGGAGCTACTGCCTTGCCCCCAGGA
GATCTAAGACATGGCACCCAAGAAGGCCAAGAGAAGGGCAGGAGCGGAAGGGAGCTCCAACGTCTTCTCC
ATGTTTGACCAGACTCAGATCCAGGAGTTCAAGGAGGCGTTCACTGTAATTGATCAGAACAGGGATGGCA
TTATCGACAAAGAGGATCTTCGGGACACCTTTGCAGCCATGGGCCGTCTCAATGTGAAGAATGAGGAACT
CGACGCTATGATGAAGGAAGCCAGTGGGCCCATCAACTTCACTGTCTTCCTGACCATGTTTGGGGAAAAG
CTTAAGGGTGCGGACCCGGAGGATGTGATCACTGGAGCCTTCAAGGTCCTGGACCCAGAAGGGAAGGGCA
CCATCAAAAAGCAGTTCTTGGAGGAGCTGCTTACCACGCAGTGCGACCGATTTTCCCAGGAGGAGATCAA
GAACATGTGGGCAGCCTTCCCCCCAGACGTGGGCGGCAACGTGGACTACAAGAACATCTGCTACGTCATC
ACACAT
Notes:The probe template was PCR amplified from IMAGE:2225544 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2225544 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16842 same embryo
 EMAGE:16843 same embryo
 EMAGE:16841 same embryo
 EurExpress:euxassay_008765 same experiment
 MGI:4826555 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS