Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17859

Gnal guanine nucleotide binding protein, alpha stimulating, olfactory type ( MGI:95774)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17859 EMAGE:17859 EMAGE:17859 EMAGE:17859 EMAGE:17859
"Pseudo-wholemount" of euxassay_009060. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009060_01 euxassay_009060_02 euxassay_009060_03 euxassay_009060_04
EMAGE:17859 EMAGE:17859 EMAGE:17859 EMAGE:17859 EMAGE:17859
euxassay_009060_05 euxassay_009060_06 euxassay_009060_07 euxassay_009060_08 euxassay_009060_09
EMAGE:17859 EMAGE:17859 EMAGE:17859 EMAGE:17859 EMAGE:17859
euxassay_009060_10 euxassay_009060_11 euxassay_009060_12 euxassay_009060_13 euxassay_009060_14
EMAGE:17859 EMAGE:17859 EMAGE:17859 EMAGE:17859 EMAGE:17859
euxassay_009060_15 euxassay_009060_16 euxassay_009060_17 euxassay_009060_18 euxassay_009060_19
EMAGE:17859 EMAGE:17859 EMAGE:17859 EMAGE:17859
euxassay_009060_20 euxassay_009060_21 euxassay_009060_22 euxassay_009060_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17859Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17859_wholemount_strong.wlz
17859_wholemount_moderate.wlz
17859_wholemount_weak.wlz
17859_wholemount_possible.wlz
17859_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17859_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
telencephalon mantle layer
weak weak
regionalweak expression: see section 02 03 04 05 18 19 20
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 01 02 03 04 05 06 07 15 16 17 18 19
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 04 05 10 11 12 weak expression: see section 03
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36443
Entity Detected:Gnal, guanine nucleotide binding protein, alpha stimulating, olfactory type ( MGI:95774)
Sequence:sense strand is shown

>T36443
GGCCAGAGAGATGAGAGAAGAAAATGGATCCAGTGTTTTAATGATGTCACTGCGATCATTTACGTGGCGG
CCTGTAGTAGCTACAACATGGTGATCCGGGAAGATAACAATACCAACAGACTTCGGGAATCACTGGACCT
GTTTGAAAGCATCTGGAATAACAGGTGGTTGCGAACCATTTCTATCATCCTATTCTTGAACAAACAAGAC
ATGCTGGCAGAAAAAGTCTTGGCAGGGAAGTCAAAAATCGAAGACTATTTCCCGGAGTATGCCAATTATA
CTGTCCCTGAAGATGCAACACCAGATGCGGGAGAAGATCCCAAAGTTACAAGAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 89996. Forward Primer - name:089996_F_cDNA_Gnal, sequence:GGCCAGAGAGATGAGAGAAGAA; Reverse Primer - name:089996_N_SP6_cDNA_Gnal, sequence:GCTCTTGTAACTTTGGGATCTTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17857 same embryo
 EMAGE:17858 same embryo
 EMAGE:17856 same embryo
 EMAGE:17860 same embryo
 EurExpress:euxassay_009060 same experiment
 MGI:4825129 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS