Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18123

Upk2 uroplakin 2 ( MGI:98913)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18123 EMAGE:18123 EMAGE:18123 EMAGE:18123 EMAGE:18123
"Pseudo-wholemount" of euxassay_011940. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011940_01 euxassay_011940_02 euxassay_011940_03 euxassay_011940_04
EMAGE:18123 EMAGE:18123 EMAGE:18123 EMAGE:18123 EMAGE:18123
euxassay_011940_05 euxassay_011940_06 euxassay_011940_07 euxassay_011940_08 euxassay_011940_09
EMAGE:18123 EMAGE:18123 EMAGE:18123 EMAGE:18123 EMAGE:18123
euxassay_011940_10 euxassay_011940_11 euxassay_011940_12 euxassay_011940_13 euxassay_011940_14
EMAGE:18123 EMAGE:18123 EMAGE:18123 EMAGE:18123 EMAGE:18123
euxassay_011940_15 euxassay_011940_16 euxassay_011940_17 euxassay_011940_18 euxassay_011940_19
EMAGE:18123 EMAGE:18123 EMAGE:18123 EMAGE:18123
euxassay_011940_20 euxassay_011940_21 euxassay_011940_22 euxassay_011940_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18123Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18123_wholemount_strong.wlz
18123_wholemount_moderate.wlz
18123_wholemount_weak.wlz
18123_wholemount_possible.wlz
18123_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18123_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 13 14 15 16 17 18 19 20 21
humerus
moderate moderate
homogeneousmoderate expression: see section 01 02 03 17 18 19 20 21 22 23
fibula
moderate moderate
homogeneousmoderate expression: see section 01 02 23
tibia
moderate moderate
homogeneousmoderate expression: see section 01 02 23
femur
moderate moderate
homogeneousmoderate expression: see section 02 03 04 05 06 07 17 18 19 20 21 22
viscerocranium
weak weak
homogeneousExpression in the turbinate bone.
meckel's cartilage
moderate moderate
homogeneousmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20
axial skeleton
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14
basioccipital bone
moderate moderate
homogeneousmoderate expression: see section 02 03 15 16 17 18 19 21
basisphenoid bone
moderate moderate
homogeneousmoderate expression: see section 07 08 09 10 11 12 13 14
temporal bone petrous part
moderate moderate
homogeneousmoderate expression: see section 01 02 19 20 21 22
vault of skull
moderate moderate
homogeneousmoderate expression: see section 01
orbito-sphenoid
moderate moderate
homogeneousmoderate expression: see section 02 03 04 06 07 08 18 19 20 21 22 23
scapula
moderate moderate
homogeneousmoderate expression: see section 01 02 03 18 19
pelvic girdle skeleton
moderate moderate
homogeneousmoderate expression: see section 08 09 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37195
Entity Detected:Upk2, uroplakin 2 ( MGI:98913)
Sequence:sense strand is shown

>T37195
TGCAGACTTCAACATCTCAAGCCTCTCTGGTCTGCTGTCTCCGGCGCTAACAGAAAGCCTGTTAATTGCC
TTGCCCCCATGTCACCTCACGGGAGGTAATGCCACATTGATGGTCCGGAGAGCCAACGACAGCAAAGTGG
TTAAGTCAGACTTTGTGGTGCCTCCATGTCGCGGGCGCAGGGAGCTTGTGAGCGTGGTGGACAGTGGGTC
TGGCTACACCGTCACAAGGCTCAGCGCATATCAGGTGACAAACCTAACACCAGGAACCAAATACTACATA
TCCTACCGAGTACAGAAGGGGACGTCGACCGAGTCCAGTCCAGAGACTCCCATGTCCACGCTTCCTCGAA
AAAACATGGAGTCTATTGGGTTAGGAATGGCCCGGACAGGAGGGATGGTGGTCATCACAGTGCTGCTGTC
TGTGGCCATGTTCCTGTTGGTCGTGGGTCTTATTGTTGCCCTGCACTGGGATGCCCGCAAATGAAAAGGG
CTCTCCTGCATCCCAGGCTCCTCCAAGAAGTCCAGCCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 89691. Forward Primer - name:089691_F_cDNA_Upk2, sequence:TGCAGACTTCAACATCTCAAGC; Reverse Primer - name:089691_N_SP6_cDNA_Upk2, sequence:AGGCTGGACTTCTTGGAGGAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18122 same embryo
 EMAGE:18126 same embryo
 EMAGE:18125 same embryo
 EMAGE:18124 same embryo
 EurExpress:euxassay_011940 same experiment
 MGI:4829110 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS