Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18536

Slc25a27 solute carrier family 25, member 27 ( MGI:1921261)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18536 EMAGE:18536 EMAGE:18536 EMAGE:18536 EMAGE:18536
"Pseudo-wholemount" of euxassay_014487. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014487_01 euxassay_014487_02 euxassay_014487_03 euxassay_014487_04
EMAGE:18536 EMAGE:18536 EMAGE:18536 EMAGE:18536 EMAGE:18536
euxassay_014487_05 euxassay_014487_06 euxassay_014487_07 euxassay_014487_08 euxassay_014487_09
EMAGE:18536 EMAGE:18536 EMAGE:18536 EMAGE:18536 EMAGE:18536
euxassay_014487_10 euxassay_014487_11 euxassay_014487_12 euxassay_014487_13 euxassay_014487_14
EMAGE:18536 EMAGE:18536 EMAGE:18536 EMAGE:18536 EMAGE:18536
euxassay_014487_15 euxassay_014487_16 euxassay_014487_17 euxassay_014487_18 euxassay_014487_19
EMAGE:18536 EMAGE:18536 EMAGE:18536
euxassay_014487_20 euxassay_014487_21 euxassay_014487_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18536Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18536_wholemount_strong.wlz
18536_wholemount_moderate.wlz
18536_wholemount_weak.wlz
18536_wholemount_possible.wlz
18536_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18536_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
facial vii ganglion
weak weak
regionalweak expression: see section 03 04
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 04 14
trigeminal v ganglion
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 15 16 17 18 19
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 04
trigeminal v nerve
weak weak
regionalweak expression: see section 15
spinal cord
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 03 04 12 weak expression: see section 05 06 07 08
neural retina
weak weak
regionalweak expression: see section 02 03 04 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38006
Entity Detected:Slc25a27, solute carrier family 25, member 27 ( MGI:1921261)
Sequence:sense strand is shown

>T38006
GTCCAATCTCTCAAGACCAACCACTGAGACACAGCAAGGCGTTTGCTAACGGATGGAACCCAGACCACTT
TGACCTTGGGCCAGGAGGTTTGGACGTTGAGCTGCTGATCTGTGCAGAAGCAGCATCTGCCTTAGAGGAG
CAGCAGAGACAGCCAGCATCCCAGGCCTGGATAGACGTCATCCATGTGGAAGACTAGTGCTTAGGAAACA
CATTTAACCTTTGAGCCAGTTATTTATTGTTGCCGTTTGACAACTCTCGCTTTTCTGTTCGTAGAGTGCA
CATATCGTAATCTACACAGAGGCAAATGAGAAGTCATGAATAAACATCTTGAGTTTTCTTAGTGCTGAAA
GAAGTCGCTTAACCTTTTCCTGCAAGGAGGATGGAAAGATAAAAGAGGCAACTTGAAGTGATGTTGGATT
GCAAGGAAAGAGGCCTCTTGATCCTGGGTCTGCTGCCTTTGCAGGTGTCCTTTACTGGTTGCCACTGCTT
TATGCATGCTAGAGGCTAGAGATATCCCCTGACAGCCACAGTCTGTCCGTAAGAACAGAACGCTTGCTCT
GGAACACATTCCATTACAACCACATTGGCCCATAGCTCTGAGAAGCATAACCAAGAGAACCACAATATAC
TTGTCTGAGACTGAGCTCTCGGGGCGTTCTTAGGAAGCGCCTCATACGGTCATCAGCTTTTCAGGAATGT
TTTGGGAGCAAGCTTACTCTCTCTTGTGTCACCCTCTGCATCTCTCTTCTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 65710. Forward Primer - name:065710_F_cDNA_Slc25a27, sequence:GTCCAATCTCTCAAGACCAACC; Reverse Primer - name:065710_N_SP6_cDNA_Slc25a27, sequence:GAGAAGAGAGATGCAGAGGGTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18535 same embryo
 EMAGE:18534 same embryo
 EMAGE:18538 same embryo
 EMAGE:18537 same embryo
 EurExpress:euxassay_014487 same experiment
 MGI:4828153 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS