Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18575

Pcdhb8 protocadherin beta 8 ( MGI:2136742)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18575 EMAGE:18575 EMAGE:18575 EMAGE:18575 EMAGE:18575
"Pseudo-wholemount" of euxassay_014520. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014520_01 euxassay_014520_02 euxassay_014520_03 euxassay_014520_04
EMAGE:18575 EMAGE:18575 EMAGE:18575 EMAGE:18575 EMAGE:18575
euxassay_014520_05 euxassay_014520_06 euxassay_014520_07 euxassay_014520_08 euxassay_014520_09
EMAGE:18575 EMAGE:18575 EMAGE:18575 EMAGE:18575 EMAGE:18575
euxassay_014520_10 euxassay_014520_11 euxassay_014520_12 euxassay_014520_13 euxassay_014520_14
EMAGE:18575 EMAGE:18575 EMAGE:18575 EMAGE:18575 EMAGE:18575
euxassay_014520_15 euxassay_014520_16 euxassay_014520_17 euxassay_014520_18 euxassay_014520_19
EMAGE:18575 EMAGE:18575 EMAGE:18575 EMAGE:18575 EMAGE:18575
euxassay_014520_20 euxassay_014520_21 euxassay_014520_22 euxassay_014520_23 euxassay_014520_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18575Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18575_wholemount_strong.wlz
18575_wholemount_moderate.wlz
18575_wholemount_weak.wlz
18575_wholemount_possible.wlz
18575_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18575_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 20 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 18 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 17 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 17 18
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 17 18 19
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 16
spinal cord
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 17 18
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38572
Entity Detected:Pcdhb8, protocadherin beta 8 ( MGI:2136742)
Sequence:sense strand is shown

>T38572
CAACATCACAATCACGGTCTCTGACCTGGGCACACCCAGGCTCACAACCCAGCACACCATAACAGTGCAA
GTGTCCGACATCAACGATAATGCTCCTGCCTTCACTCAAACCTCTTACACCTTGTTTGTTCACGAGAACA
ACAGCCCTGCCCTGCACATAGGCACCATCAGCGCCACAGACTCAGACTCTGGCTCCAATGGCCTTATTAT
CTACTCGTTGCTGCCGCCCCATGACCAGCAGCTGGGCCTTGCCTCGCTGATCTCCATCAACTCAGACAAC
GGGCAGCTGTTTGCGCTCAGGGCGCTGGACTACGAGGCCCTGCAGGCCTTCGAGTTCCACGTGGGCGCCA
CAGACAGAGGCTCGCCCGCGCTCAGCTCAGAGGCTCTGGTGCGCGTAGTGGTGCTGGATGACAATGACAA
TGCGCCCTTCGTGCTCTACCCACTGCAAAACGCTTCTGCGCCCTGCACTGAGCTGCTGCCCAGGGCTGCG
GAGCCTGGCTACCTGATCACCAAGGTGGTGGCAGTGGACCGCGACTCTGGCCAGAATGCCTGGCTGTCAT
TCCAGCTGCTCAAGGCCACAGAGCCCGGGCTGTTCAGCGTGTGGGCGCACAATGGCGAAGTGCGCACCAC
CAGGCTGCTGAGCGAGCGAGATGCACCCAAGCACAGGCTGCTGCTGCTGGTCAAGGACAATGGAGAGCCT
CTGCGCTCTGCTAGTGTCATGCTGCAGGTGCTAGTGGTGGATGGCTTCTCTCAGCCCTACCTGCCTCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 150091. Forward Primer - name:150091_F_cDNA_Pcdhb8, sequence:CAACATCACAATCACGGTCTCT; Reverse Primer - name:150091_N_SP6_cDNA_Pcdhb8, sequence:AGAGGCAGGTAGGGCTGAGAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18573 same embryo
 EMAGE:18572 same embryo
 EMAGE:18576 same embryo
 EMAGE:18574 same embryo
 EurExpress:euxassay_014520 same experiment
 MGI:4827087 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS