Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18711

Foxh1 forkhead box H1 ( MGI:1347465)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18711 EMAGE:18711 EMAGE:18711 EMAGE:18711 EMAGE:18711
"Pseudo-wholemount" of euxassay_016625. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016625_01 euxassay_016625_02 euxassay_016625_03 euxassay_016625_04
EMAGE:18711 EMAGE:18711 EMAGE:18711 EMAGE:18711 EMAGE:18711
euxassay_016625_05 euxassay_016625_06 euxassay_016625_07 euxassay_016625_08 euxassay_016625_09
EMAGE:18711 EMAGE:18711 EMAGE:18711 EMAGE:18711 EMAGE:18711
euxassay_016625_10 euxassay_016625_11 euxassay_016625_12 euxassay_016625_13 euxassay_016625_14
EMAGE:18711 EMAGE:18711 EMAGE:18711 EMAGE:18711 EMAGE:18711
euxassay_016625_15 euxassay_016625_16 euxassay_016625_17 euxassay_016625_18 euxassay_016625_19
EMAGE:18711 EMAGE:18711 EMAGE:18711 EMAGE:18711 EMAGE:18711
euxassay_016625_20 euxassay_016625_21 euxassay_016625_22 euxassay_016625_23 euxassay_016625_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18711Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18711_wholemount_strong.wlz
18711_wholemount_moderate.wlz
18711_wholemount_weak.wlz
18711_wholemount_possible.wlz
18711_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18711_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45071
Entity Detected:Foxh1, forkhead box H1 ( MGI:1347465)
Sequence:sense strand is shown

>T45071
AATCATAGAGGGGGAGAGTTCCCAAGGGGAGGTAATCAGGCCTTCTCCCGTCACCCCAGATCAAGGCTCC
TGGCCCCTCCACTTACTTGAGGATTCCGCAGATTCCAGGGGAGTGCCCAGGAGGGGGAGCAGAGCCTCCT
TGTGGGGACAGCTACCCACTTCTTACTTGCCCATCTATACGCCCAATGTAGTAATGCCCTTGGCCACACT
ACCGACCACCTCTTGTCCCCAGTGCCCATCTTCTGCCAGCCCAGCTTACTGGAGCGTAGGCACTGAATCC
CAAGGGTCCCAGGACCTGCTCTGTGATCTAGACTCCCTCTTCCAGGGAGTACCACCCAACAAGAGTATCT
ATGATGTGTGGGTCAGCCATCCTA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 168313. Forward Primer - name:168313_F_Foxh1, sequence:AATCATAGAGGGGGAGAGTTCC; Reverse Primer - name:168313_R_SP6_Foxh1, sequence:TAGGATGGCTGACCCACACAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18708 same embryo
 EMAGE:18709 same embryo
 EMAGE:18707 same embryo
 EMAGE:18710 same embryo
 EMAGE:18706 same embryo
 EurExpress:euxassay_016625 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS