Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18770

Tns3 tensin 3 ( MGI:2443012)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18770 EMAGE:18770 EMAGE:18770 EMAGE:18770 EMAGE:18770
"Pseudo-wholemount" of euxassay_014013. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014013_01 euxassay_014013_02 euxassay_014013_03 euxassay_014013_04
EMAGE:18770 EMAGE:18770 EMAGE:18770 EMAGE:18770 EMAGE:18770
euxassay_014013_05 euxassay_014013_06 euxassay_014013_07 euxassay_014013_08 euxassay_014013_09
EMAGE:18770 EMAGE:18770 EMAGE:18770 EMAGE:18770 EMAGE:18770
euxassay_014013_10 euxassay_014013_11 euxassay_014013_12 euxassay_014013_13 euxassay_014013_14
EMAGE:18770 EMAGE:18770 EMAGE:18770 EMAGE:18770 EMAGE:18770
euxassay_014013_15 euxassay_014013_16 euxassay_014013_17 euxassay_014013_18 euxassay_014013_19
EMAGE:18770 EMAGE:18770 EMAGE:18770 EMAGE:18770 EMAGE:18770
euxassay_014013_20 euxassay_014013_21 euxassay_014013_22 euxassay_014013_23 euxassay_014013_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18770Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18770_wholemount_strong.wlz
18770_wholemount_moderate.wlz
18770_wholemount_weak.wlz
18770_wholemount_possible.wlz
18770_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18770_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hand mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 21 22 23 24
hindlimb digit 1 mesenchyme
moderate moderate
regionalmoderate expression: see section 07 08 09 20 21 22
hindlimb digit 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 07 08 09 10 20 21 22
hindlimb digit 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 07 08 09 10 20 21 22
hindlimb digit 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 07 08 09 10 21 22
interdigital region between hindlimb digits 1 and 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 08 09 10 21 22
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 23 24
spleen primordium
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07
vibrissa
moderate moderate
regionalmoderate expression: see section 05 06 07 21 22 weak expression: see section 04
nasal septum
moderate moderate
spottedmoderate expression: see section 12 13 14 15 16
mandible
moderate moderate
regionalmoderate expression: see section 21 22 weak expression: see section 03 04 05 06 07 08 09 10 17 18 20
maxilla
moderate moderate
regionalmoderate expression: see section 22 weak expression: see section 04 09 10
male reproductive system
moderate moderate
regionalmoderate expression: see section 14 15
trachea
weak weak
regionalweak expression: see section 12 13
exoccipital bone
moderate moderate
spottedmoderate expression: see section 01 02 03 04 17 18 19 20 21 22
orbito-sphenoid
moderate moderate
spottedmoderate expression: see section 01 02 03 04 18 19 20 21 22
viscerocranium
moderate moderate
spottedExpression in the turbinate bone.
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 14 15 16 17 18
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39675
Entity Detected:Tns3, tensin 3 ( MGI:2443012)
Sequence:sense strand is shown

>T39675
GACCGTGGACTATAACACAGCAGACCCGCTGATTCGATGGGACTCCTATGAGAACATGAGTGCGGATGGA
GAAGTGCTACACACACAGGGGCCAGTGGATGGCAGCCTGTATGCCAAGGTGAGGAAGAAGAGTGCCTCAG
ATACTGGCATCCCTAGTAGCCCCCAGGGCATGCCAGCCACTAGCAGTCCAGACCACGGAGACCACACCCT
GTCAGTCAGCAGCGACTCAGGTCATTCTACTGCCTCCGCCAGGACTGATAAGACAGAAGAGCGCCTGACC
CCCGGAGCACGAAGAGGCCTGAGCCCTCAGGAGAAGGCTGAGCTGGACCAGCTGCTCAGTGGATTTGGCC
TGGAAGACTCTGCAAGCTCCCACAAAGACATGACTGATATGCGCAGCAAGTACAGTGGGACACGGCATGT
GGTACCAGCCCAGGTCCATGTGAATGGAGATGCTGCCCTAAAGGACCGGGAGACTGACATTCTAGATGAT
GAGATGCCCCATCATGATCTTCACAGTGTGGACAGCCTGGGTACTCTTTCCTCCTCTGAAGGGCCCCAGT
CCACCCACCTGGGTCCTTTCACCTGTCTCAAGAGCAGCCAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 83071. Forward Primer - name:083071_F_cDNA_Tens1, sequence:GACCGTGGACTATAACACAGCA; Reverse Primer - name:083071_N_SP6_cDNA_Tens1, sequence:CTGGCTGCTCTTGAGACAGGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18769 same embryo
 EMAGE:18767 same embryo
 EMAGE:18768 same embryo
 EurExpress:euxassay_014013 same experiment
 MGI:4828864 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS