Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18808

4930524E20Rik RIKEN cDNA 4930524E20 gene ( MGI:1922347)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18808 EMAGE:18808 EMAGE:18808 EMAGE:18808 EMAGE:18808
"Pseudo-wholemount" of euxassay_014077. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014077_01 euxassay_014077_02 euxassay_014077_03 euxassay_014077_04
EMAGE:18808 EMAGE:18808 EMAGE:18808 EMAGE:18808 EMAGE:18808
euxassay_014077_05 euxassay_014077_06 euxassay_014077_07 euxassay_014077_08 euxassay_014077_09
EMAGE:18808 EMAGE:18808 EMAGE:18808 EMAGE:18808 EMAGE:18808
euxassay_014077_10 euxassay_014077_11 euxassay_014077_12 euxassay_014077_13 euxassay_014077_14
EMAGE:18808 EMAGE:18808 EMAGE:18808 EMAGE:18808 EMAGE:18808
euxassay_014077_15 euxassay_014077_16 euxassay_014077_17 euxassay_014077_18 euxassay_014077_19
EMAGE:18808 EMAGE:18808 EMAGE:18808
euxassay_014077_20 euxassay_014077_21 euxassay_014077_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18808Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18808_wholemount_strong.wlz
18808_wholemount_moderate.wlz
18808_wholemount_weak.wlz
18808_wholemount_possible.wlz
18808_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18808_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 01 02 03 04 05 06 weak expression: see section 15 16 17 18 19
ventral grey horn
weak weak
single cellweak expression: see section 08 09 11 12 13
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 14 15 weak expression: see section 06 07 08
heart ventricle
strong strong
spottedstrong expression: see section 06 07 08 09 10 11 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40307
Entity Detected:4930524E20Rik, RIKEN cDNA 4930524E20 gene ( MGI:1922347)
Sequence:sense strand is shown

>T40307
AGGAGGGAGTCCTTGTAGCTCTACTGGCGCAACAGATCCATCTACCAGCTGCCATACTCGGTGAAGATGG
ATCAATCTACTTTGGGGGCTATGGCTCTTAAGCGAATCCAGAAGGAGTTAGTTGCCATCTCTCAAGATCC
CCCGGCTCACTGTTCTGCAGGGCCAGTGGCAGAAAATATGTTTCATTGGCAAGCAACCATAATGGGGCCT
GAAGACAGCCCCTACCAGGGAGGGGTTTTTTTCCTGTCCGTCCACTTTCCGAACAATTACCCCTTCAAGC
CCCCCAAAGTTACGTTCATAACCCGAGTTTACCATCCAAACATTAGCAAAAATGGAAGTATCTGTCTAGA
TATCTTGAATTCTATGTGGTCACCTGCACTCACAATTTCCAAACTTCTTCTCTCTATCTGCTCTCTATTA
TGTGATCCAAACCCAGATGACCCTCTGGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 86796. Forward Primer - name:086796_F_cDNA_4930524E20Rik, sequence:AGGAGGGAGTCCTTGTAGCTCT; Reverse Primer - name:086796_N_SP6_cDNA_4930524E20Rik, sequence:ACCAGAGGGTCATCTGGGTTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18812 same embryo
 EMAGE:18813 same embryo
 EMAGE:18809 same embryo
 EMAGE:18810 same embryo
 EMAGE:18811 same embryo
 EurExpress:euxassay_014077 same experiment
 MGI:4822733 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS