Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19001

C230086J09Rik RIKEN cDNA C230086J09 gene ( MGI:2443423)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19001 EMAGE:19001 EMAGE:19001 EMAGE:19001 EMAGE:19001
"Pseudo-wholemount" of euxassay_015784. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_015784_01 euxassay_015784_02 euxassay_015784_03 euxassay_015784_04
EMAGE:19001 EMAGE:19001 EMAGE:19001 EMAGE:19001 EMAGE:19001
euxassay_015784_05 euxassay_015784_06 euxassay_015784_07 euxassay_015784_08 euxassay_015784_09
EMAGE:19001 EMAGE:19001 EMAGE:19001 EMAGE:19001 EMAGE:19001
euxassay_015784_10 euxassay_015784_11 euxassay_015784_12 euxassay_015784_13 euxassay_015784_14
EMAGE:19001 EMAGE:19001 EMAGE:19001 EMAGE:19001 EMAGE:19001
euxassay_015784_15 euxassay_015784_16 euxassay_015784_17 euxassay_015784_18 euxassay_015784_19
EMAGE:19001 EMAGE:19001 EMAGE:19001
euxassay_015784_20 euxassay_015784_21 euxassay_015784_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19001Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19001_wholemount_strong.wlz
19001_wholemount_moderate.wlz
19001_wholemount_weak.wlz
19001_wholemount_possible.wlz
19001_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19001_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 06 07 08 09 11 12 13 14 15 16
cerebral cortex mantle layer
weak weak
regionalweak expression: see section 01 02 03 04 05 06 20 21 22
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 10 11 12 13 14 weak expression: see section 09
rest of cerebellum mantle layer
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 12 13 14 15 16
pons mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 12 13 14 15 16
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 17 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03
ventral grey horn
weak weak
regionalweak expression: see section 06 07 08 09 10
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40472
Entity Detected:C230086J09Rik, RIKEN cDNA C230086J09 gene ( MGI:2443423)
Sequence:sense strand is shown

>T40472
GAAATGGCATCTCCTACCCATAATCTTAACACTCTACAGACTTAGAAAAAAGAATTATTAGAAGTTCAAG
GCATACCAAATTATAAGTGAGACATATAAAAAATGCAAATAAAAAATAAATAAGCAATAATTTTCATTAC
ATCTTTTCTGCATCATTTTCACCTGCTGAATTTCAAGTGGAATTTCTTGCCACTGTTCATTAGAAGAGAA
AAATTCCACACATGCCCAGATAATATATCTAGTTACTAGCAGTCACTCTCTGAAGCACTGCTATTGATAA
ACATTCTGTTAAATTTGAATTCTCGATGGTTAAGCCATTCCCCTACTATGGTTGTTTTCTAACCTTTCTT
TTATAGATGAGCGACACAGAACAGACAATTCAGTCACTCTGATAAATCAACAAATCCCTGCTTGCAAAGC
TCCATCTCTCCCATTTTTCCTTGCCAAATCTTTTATCTTCCTTTGTTGTTAACAGGATCAGAGAGATTAC
CAAAGTATGGAAAGGTGGGCTGCCTTTTTCTATAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 158397. Forward Primer - name:158397_F_cDNA_Mm.26072, sequence:GAAATGGCATCTCCTACCCATA; Reverse Primer - name:158397_N_SP6_cDNA_Mm.26072, sequence:ttatagaaaaaggcagcccac. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19005 same embryo
 EMAGE:19004 same embryo
 EMAGE:19003 same embryo
 EMAGE:19002 same embryo
 EMAGE:19000 same embryo
 EurExpress:euxassay_015784 same experiment
 MGI:4823551 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS