Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19096

Mir742 microRNA 742 ( MGI:3709840)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19096 EMAGE:19096 EMAGE:19096 EMAGE:19096 EMAGE:19096
"Pseudo-wholemount" of euxassay_019446. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019446_01 euxassay_019446_02 euxassay_019446_03 euxassay_019446_04
EMAGE:19096 EMAGE:19096 EMAGE:19096 EMAGE:19096 EMAGE:19096
euxassay_019446_05 euxassay_019446_06 euxassay_019446_07 euxassay_019446_08 euxassay_019446_09
EMAGE:19096 EMAGE:19096 EMAGE:19096 EMAGE:19096 EMAGE:19096
euxassay_019446_10 euxassay_019446_11 euxassay_019446_12 euxassay_019446_13 euxassay_019446_14
EMAGE:19096 EMAGE:19096 EMAGE:19096 EMAGE:19096 EMAGE:19096
euxassay_019446_15 euxassay_019446_16 euxassay_019446_17 euxassay_019446_18 euxassay_019446_19
EMAGE:19096 EMAGE:19096 EMAGE:19096 EMAGE:19096 EMAGE:19096
euxassay_019446_20 euxassay_019446_21 euxassay_019446_22 euxassay_019446_23 euxassay_019446_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19096Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19096_wholemount_strong.wlz
19096_wholemount_moderate.wlz
19096_wholemount_weak.wlz
19096_wholemount_possible.wlz
19096_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19096_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
exoccipital bone
weak weak
regionalweak expression: see section 01 02 03 04 05 18 20 21
temporal bone
weak weak
regionalweak expression: see section 01 02 03 04 05 20 21 22 23 24
orbito-sphenoid
weak weak
regionalweak expression: see section 01 02 03 06 07 08 18 19 20 21 24
viscerocranium
weak weak
regionalExpression in the turbinate bone.
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70172
Entity Detected:Mir742, microRNA 742 ( MGI:3709840)
Sequence:sense strand is shown

>T70172
GAAAGCCACCATGCTGGGTAAA
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-742 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19097 same embryo
 EMAGE:19095 same embryo
 EMAGE:19094 same embryo
 EMAGE:19093 same embryo
 EMAGE:19092 same embryo
 EurExpress:euxassay_019446 same experiment
 MGI:4826375 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS