Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19146

Mir34c microRNA 34c ( MGI:3619365)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19146 EMAGE:19146 EMAGE:19146 EMAGE:19146 EMAGE:19146
"Pseudo-wholemount" of euxassay_019406. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019406_01 euxassay_019406_02 euxassay_019406_03 euxassay_019406_04
EMAGE:19146 EMAGE:19146 EMAGE:19146 EMAGE:19146 EMAGE:19146
euxassay_019406_05 euxassay_019406_06 euxassay_019406_07 euxassay_019406_08 euxassay_019406_09
EMAGE:19146 EMAGE:19146 EMAGE:19146 EMAGE:19146 EMAGE:19146
euxassay_019406_10 euxassay_019406_11 euxassay_019406_12 euxassay_019406_13 euxassay_019406_14
EMAGE:19146 EMAGE:19146 EMAGE:19146 EMAGE:19146 EMAGE:19146
euxassay_019406_15 euxassay_019406_16 euxassay_019406_17 euxassay_019406_18 euxassay_019406_19
EMAGE:19146 EMAGE:19146 EMAGE:19146
euxassay_019406_20 euxassay_019406_21 euxassay_019406_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19146Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19146_wholemount_strong.wlz
19146_wholemount_moderate.wlz
19146_wholemount_weak.wlz
19146_wholemount_possible.wlz
19146_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19146_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 01 04 05 06 07 08 09 15 16 weak expression: see section 02 03 17 18 19 20 21 22
humerus
moderate moderate
regionalmoderate expression: see section 01 02 03 20 21 22
fibula
weak weak
regionalweak expression: see section 01 02 03 04
tibia
weak weak
regionalweak expression: see section 02 03
femur
weak weak
regionalweak expression: see section 02 03 04 06 07 21 22
lateral ventricle choroid plexus
weak weak
regionalweak expression: see section 05 06 07 08 09 10 12 15 16
metencephalon part of 4th ventricle choroid plexus
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15
hyoid
weak weak
regionalweak expression: see section 09 10 11 12 13 14
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 04 08 09 15 16 17 18 19 20 weak expression: see section 02 03 05 06 07 10 11 12 14
axial skeleton
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 15 weak expression: see section 14
basioccipital bone
moderate moderate
regionalmoderate expression: see section 05 09 10 12 13 weak expression: see section 06 07 08 11
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 09 10 12 13 weak expression: see section 08 11
exoccipital bone
moderate moderate
regionalmoderate expression: see section 14 15 weak expression: see section 01 03
temporal bone
weak weak
regionalweak expression: see section 01 03 18 19 20
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 01 04 06 07 08 18 19 20
viscerocranium
weak weak
regionalExpression in the turbinate bone.
clavicle
moderate moderate
regionalmoderate expression: see section 04 weak expression: see section 05 06 07 15 16
scapula
moderate moderate
regionalmoderate expression: see section 01 02 03 19 20 21
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 10 17 19 20 weak expression: see section 07 08 09
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70432
Entity Detected:Mir34c, microRNA 34c ( MGI:3619365)
Sequence:sense strand is shown

>T70432
AGGCAGTGTAGTTAGCTGATTGC
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-34c was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19145 same embryo
 EurExpress:euxassay_019406 same experiment
 MGI:4826276 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS