Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19169

Snapc3 small nuclear RNA activating complex, polypeptide 3 ( MGI:1916338)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19169 EMAGE:19169 EMAGE:19169 EMAGE:19169 EMAGE:19169
"Pseudo-wholemount" of euxassay_009132. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009132_01 euxassay_009132_02 euxassay_009132_03 euxassay_009132_04
EMAGE:19169 EMAGE:19169 EMAGE:19169 EMAGE:19169 EMAGE:19169
euxassay_009132_05 euxassay_009132_06 euxassay_009132_07 euxassay_009132_08 euxassay_009132_09
EMAGE:19169 EMAGE:19169 EMAGE:19169 EMAGE:19169 EMAGE:19169
euxassay_009132_10 euxassay_009132_11 euxassay_009132_12 euxassay_009132_13 euxassay_009132_14
EMAGE:19169 EMAGE:19169 EMAGE:19169 EMAGE:19169 EMAGE:19169
euxassay_009132_15 euxassay_009132_16 euxassay_009132_17 euxassay_009132_18 euxassay_009132_19
EMAGE:19169
euxassay_009132_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19169Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19169_wholemount_strong.wlz
19169_wholemount_moderate.wlz
19169_wholemount_weak.wlz
19169_wholemount_possible.wlz
19169_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19169_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 06 17 18
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 16
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 16 17 18 19
vagus x ganglion
strong strong
regionalstrong expression: see section 06 07 15 16
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 07 16
trigeminal v nerve
strong strong
regionalstrong expression: see section 10 16
spinal cord
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 07 08 13
cervical ganglion
strong strong
regionalstrong expression: see section 07 08 15
thoracic ganglion
strong strong
regionalstrong expression: see section 10 11 12
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16
neural retina
strong strong
regionalstrong expression: see section 02 03 04 05
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3457
Entity Detected:Snapc3, small nuclear RNA activating complex, polypeptide 3 ( MGI:1916338)
Sequence:sense strand is shown

>T3457
CTGACATGGCGGAGGACNGGCAGGGCGGCGGTGCGGGTGGCCCACAGCACCCAGTCCCCAGTGCGAGCCA
CAGCAGCTTTCCGGAATACGAGCTTCCCGAGTTGCACACGCGCGTGTTCCATGTGGGCTCCTTTGGGGAG
CTATGGCGTGGCCGGCTAGGGGCCCAGGATTTGTCGCTGAGCGAACCGCAGGCAGCCGAGCAGCCGACCG
ACGGAGGGGCATCCAACGACGGCTTTGAGGATGCTGCAGTAGCCAGCGATCTGGGCTGCAGTCTGGAGGC
AGCAGCAGAGCTGAGGGTCGTGTGCGGCCTTGATAAACTGAGATGCCTCGGGGAAGATGAAGACCCGGAA
GTCATCCCAGAGAACACTGACCTAGTGACTTTATGTGTGAGGAAGGGGCTTTTGGACTATCGGGAAGAAA
ACATCACAATAGATCGCGCCTGTAGACAAGAAATATTTGCTTATGAAATGGAATCTCATGCACTAGGGAA
GAAACCTGAAAACCCAGCAGACATGATTGAAGAAGGAGAGTGTATCCTATCT
Notes:The probe template was PCR amplified from IMAGE:329883 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:329883 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19170 same embryo
 EMAGE:19171 same embryo
 EMAGE:19168 same embryo
 EMAGE:19167 same embryo
 EurExpress:euxassay_009132 same experiment
 MGI:4828345 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS