Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19731

2310033P09Rik RIKEN cDNA 2310033P09 gene ( MGI:1915112)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19731 EMAGE:19731 EMAGE:19731 EMAGE:19731 EMAGE:19731
"Pseudo-wholemount" of euxassay_006179. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006179_01 euxassay_006179_02 euxassay_006179_03 euxassay_006179_04
EMAGE:19731 EMAGE:19731 EMAGE:19731 EMAGE:19731 EMAGE:19731
euxassay_006179_05 euxassay_006179_06 euxassay_006179_07 euxassay_006179_08 euxassay_006179_09
EMAGE:19731 EMAGE:19731 EMAGE:19731 EMAGE:19731 EMAGE:19731
euxassay_006179_10 euxassay_006179_11 euxassay_006179_12 euxassay_006179_13 euxassay_006179_14
EMAGE:19731 EMAGE:19731 EMAGE:19731 EMAGE:19731 EMAGE:19731
euxassay_006179_15 euxassay_006179_16 euxassay_006179_17 euxassay_006179_18 euxassay_006179_19
EMAGE:19731 EMAGE:19731
euxassay_006179_20 euxassay_006179_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19731Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19731_wholemount_strong.wlz
19731_wholemount_moderate.wlz
19731_wholemount_weak.wlz
19731_wholemount_possible.wlz
19731_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19731_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 10 11 12 13
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 weak expression: see section 02 03 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
medulla oblongata basal plate ventricular layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12
rest of cerebellum ventricular layer
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
pons ventricular layer
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
midbrain ventricular layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T459
Entity Detected:2310033P09Rik, RIKEN cDNA 2310033P09 gene ( MGI:1915112)
Sequence:sense strand is shown

>T459
CTGTTGNCCTACTGGGTGCTGCGGGTAAGTCCGACTAGAGACCGCGGGTACTGAAGGCTGTGCAGTGGCT
CCAGCGCCATGTTCGGCTCCAATCGCGGTGGCGTGCGTGGCGGACAAGACCAGTTCAATTGGGAGGACGT
GAAGACTGACAAGCAGAGGGAGAACTACTTGGGCAACTCGCTGATGGCGCCAGTAGGCCGCTGGCAGAAG
GGCCGCGACCTCACCTGGTACGCGAAGGACCGCGCGCCGTGTACCGGCCCGAGCCGTGAGGAAGAGCTGG
CAGCCGTGCGCGAGGCGGAGCGTGAGGCGCTGCTGGCCGCACTTGGTTACAAGAACGTGAGGAAACAGCC
CACCGGCCTGAGCAAGGAGGACTTCGTGGAGATCTGCAAACGGGAAGGAGGAGACCCCGAGGAGAAGGGC
GTGGACCGGCTCCTGGGCTTGGGCAGCGCCAGTGGCTCCGCGGGCCGTGTGGCGCTATCCCGAGAAGACA
AAGAGGCTGCCAAACTTGGGCTGTCAGTGTTCACG
Notes:The probe template was PCR amplified from IMAGE:1450319 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1450319 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19729 same embryo
 EMAGE:19730 same embryo
 EurExpress:euxassay_006179 same experiment
 MGI:4822663 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS