Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19809

Bex4 brain expressed gene 4 ( MGI:3606746)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19809 EMAGE:19809 EMAGE:19809 EMAGE:19809 EMAGE:19809
"Pseudo-wholemount" of euxassay_006309. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006309_01 euxassay_006309_02 euxassay_006309_03 euxassay_006309_04
EMAGE:19809 EMAGE:19809 EMAGE:19809 EMAGE:19809 EMAGE:19809
euxassay_006309_05 euxassay_006309_06 euxassay_006309_07 euxassay_006309_08 euxassay_006309_09
EMAGE:19809 EMAGE:19809 EMAGE:19809 EMAGE:19809 EMAGE:19809
euxassay_006309_10 euxassay_006309_11 euxassay_006309_12 euxassay_006309_13 euxassay_006309_14
EMAGE:19809 EMAGE:19809 EMAGE:19809 EMAGE:19809 EMAGE:19809
euxassay_006309_15 euxassay_006309_16 euxassay_006309_17 euxassay_006309_18 euxassay_006309_19
EMAGE:19809 EMAGE:19809 EMAGE:19809 EMAGE:19809 EMAGE:19809
euxassay_006309_20 euxassay_006309_21 euxassay_006309_22 euxassay_006309_23 euxassay_006309_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19809Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19809_wholemount_strong.wlz
19809_wholemount_moderate.wlz
19809_wholemount_weak.wlz
19809_wholemount_possible.wlz
19809_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19809_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 16 17 18 weak expression: see section 06
pancreas
moderate moderate
regionalmoderate expression: see section 07 08 09 10 12 13 14 15 16
stomach
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 weak expression: see section 01 02 03 04
rectum
moderate moderate
regionalmoderate expression: see section 12
midgut
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
kidney calyx
weak weak
regionalweak expression: see section 05 06 07 08 14 15 16 17 18
urethra of male
weak weak
regionalweak expression: see section 11 12 13
lung
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 09 10 11 12 13 14 15 16 17 18 19 22 moderate expression: see section 08 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35004
Entity Detected:Bex4, brain expressed gene 4 ( MGI:3606746)
Sequence:sense strand is shown

>T35004
AGAAAGAGGAGAAGGCAAGGATAGGCCCAGGAGTGATGGCATCCAAATTTAAACAAGTCATACTGGATCT
CACTGTGGAGAAAGACAAAAAAGACAAAAAAGGTGGGAAGGCCTCCAAACAAAGTGAAGAAGAACCCCAC
CATCTGGAAGAGGTTGAAAACAAGAAGCCTGGGGGAAATGTCCGAAGGAAAGTCAGGCGACTTGTGCCTA
ACTTTCTCTGGGCCATACCAAATAGGCATGTTGATCGCAATGAAGGGGGAGAGGATGTTGGGAGATTTGT
AGTGCAGGGAACAGAAGTCAAGAGAAAGACTACGGAGCAGCAGGTGAGGCCTTACAGGCGTTTCCGAACC
CCGGAACCTGACAATCATTACGACTTTTGCCTCATACCTTGAAATCTAAGATTTTCTCTGAGCTCATAAA
ATGGCTACTGTTTTACAAGCTCTTATCAAGTGGGGGTATTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 50035. Forward Primer - name:050035_F_cDNA_LOC406217, sequence:AGAAAGAGGAGAAGGCAAGGAT; Reverse Primer - name:050035_N_SP6_cDNA_LOC406217, sequence:AAATACCCCCACTTGATAAGAGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19811 same embryo
 EMAGE:19806 same embryo
 EMAGE:19808 same embryo
 EMAGE:19807 same embryo
 EMAGE:19810 same embryo
 EurExpress:euxassay_006309 same experiment
 MGI:4823461 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS