Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20082

Scd3 stearoyl-coenzyme A desaturase 3 ( MGI:1353437)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20082 EMAGE:20082 EMAGE:20082 EMAGE:20082 EMAGE:20082
"Pseudo-wholemount" of euxassay_012236. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012236_01 euxassay_012236_02 euxassay_012236_03 euxassay_012236_04
EMAGE:20082 EMAGE:20082 EMAGE:20082 EMAGE:20082 EMAGE:20082
euxassay_012236_05 euxassay_012236_06 euxassay_012236_07 euxassay_012236_08 euxassay_012236_09
EMAGE:20082 EMAGE:20082 EMAGE:20082 EMAGE:20082 EMAGE:20082
euxassay_012236_10 euxassay_012236_11 euxassay_012236_12 euxassay_012236_13 euxassay_012236_14
EMAGE:20082 EMAGE:20082 EMAGE:20082 EMAGE:20082 EMAGE:20082
euxassay_012236_15 euxassay_012236_16 euxassay_012236_17 euxassay_012236_18 euxassay_012236_19
EMAGE:20082 EMAGE:20082 EMAGE:20082 EMAGE:20082 EMAGE:20082
euxassay_012236_20 euxassay_012236_21 euxassay_012236_22 euxassay_012236_23 euxassay_012236_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20082Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20082_wholemount_strong.wlz
20082_wholemount_moderate.wlz
20082_wholemount_weak.wlz
20082_wholemount_possible.wlz
20082_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20082_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 03 04 05 06 07 17 18 19 20 21 22 moderate expression: see section 02 23 24
adrenal gland
moderate moderate
regionalmoderate expression: see section 07 08 15 16 weak expression: see section 06 09 17
thymus primordium
strong strong
regionalstrong expression: see section 10 11 12 13 14
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 16 17 weak expression: see section 18
pancreas
moderate moderate
regionalmoderate expression: see section 07 08 weak expression: see section 09
pituitary gland
moderate moderate
regionalmoderate expression: see section 13 14 15 weak expression: see section 10 11 12
vibrissa
strong strong
regionalstrong expression: see section 04 05 06 19 20 21 moderate expression: see section 03
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14
olfactory cortex marginal layer
strong strong
homogeneousstrong expression: see section 15 moderate expression: see section 10 11 12 14
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 15 16 moderate expression: see section 10 11
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 08 09 15 16 17 18 19 20 21 22 moderate expression: see section 02 10 11 12 14
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 08 16 moderate expression: see section 09 15
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 moderate expression: see section 08
rest of cerebellum ventricular layer
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 17 18 19 moderate expression: see section 08 09 13 20 21 weak expression: see section 10 11 14 15 16
pons ventricular layer
strong strong
homogeneousstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
midbrain ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 moderate expression: see section 07 16
facial vii ganglion
strong strong
regionalstrong expression: see section 05 06 18 19 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 07 17
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 18 19 20 21
vagus x ganglion
strong strong
regionalstrong expression: see section 08 16
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 17 18
trigeminal v nerve
strong strong
regionalstrong expression: see section 09 moderate expression: see section 10 16
basal columns
moderate moderate
regionalmoderate expression: see section 12
ventral grey horn
moderate moderate
regionalmoderate expression: see section 10 11 13 14
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 10 11 12
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 09 15
thoracic ganglion
strong strong
regionalstrong expression: see section 11
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 14 15 16 17
otic capsule
moderate moderate
regionalmoderate expression: see section 06 07 08 09 15 16 17 18
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 weak expression: see section 03 04 21 22 23 24
lens
strong strong
regionalstrong expression: see section 01 24
neural retina
strong strong
regionalstrong expression: see section 01 02 03 22 23 24
tongue muscle
weak weak
regionalweak expression: see section 12 13 14
stomach
weak weak
regionalweak expression: see section 04 05 06 07
hindgut
strong strong
regionalstrong expression: see section 13 moderate expression: see section 11 12
rectum
strong strong
regionalstrong expression: see section 12
midgut
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 07 08 09 10 11 12 15
mandible
strong strong
regionalstrong expression: see section 03 22 moderate expression: see section 02 04 05 06 07 08 09 10 15 16 17 18 19 20 21
lower jaw incisor
strong strong
regionalstrong expression: see section 10 11 12 13 14 15
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 18 19
maxilla
moderate moderate
regionalmoderate expression: see section 05 06 07 08 17 18 19 20 21
upper jaw incisor
strong strong
regionalstrong expression: see section 11 12 15 16
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 18 19
liver lobe
strong strong
regionalstrong expression: see section 08 11 12 13 14 15 16 17 19 20 21 22 23 24 moderate expression: see section 01 02 03 04 05 06 07 09 10 18
metanephros
weak weak
regionalweak expression: see section 05 06 07 08 09 15 16 17 18 19
male reproductive system
weak weak
regionalweak expression: see section 12
urethra of male
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 11 12
larynx
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 12
lung
strong strong
regionalstrong expression: see section 04 05 06 07 08 13 14 15 17 18 19 20 21 22 moderate expression: see section 02 03 09 10 11 12 16
trachea
weak weak
regionalweak expression: see section 12 13
axial skeleton
moderate moderate
regionalmoderate expression: see section 11 13
nucleus pulposus
strong strong
regionalstrong expression: see section 12
temporal bone petrous part
strong strong
regionalstrong expression: see section 01 02 03 21 22 23 moderate expression: see section 05 19 20
vault of skull
strong strong
regionalstrong expression: see section 01 02 23 24
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 21 22 23 24 moderate expression: see section 05 06 07 08 18 19 20
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
clavicle
strong strong
regionalstrong expression: see section 08 09 15 moderate expression: see section 16
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 14 15
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36992
Entity Detected:Scd3, stearoyl-coenzyme A desaturase 3 ( MGI:1353437)
Sequence:sense strand is shown

>T36992
ACGTCTGGAGGAACATCATTCTCATGGCCCTGCTGCACGTGGGAGCCCTGTACGGGATCACACTGGTTCC
CTCCTGCAAGCTCTACACCTGCCTCTTCGCGTTTGTCTACTATGTGATCAGTATTGAGGGCATTGGAGCC
GGAGTCCATCGCCTGTGGAGCCACAGAACGTACAAGGCACGCCTGCCCCTGCGGATCTTCCTCATCATTG
CCAACACCATGGCGTTCCAGAATGACGTGTATGAATGGGCCCGAGATCACCGAGCCCACCACAAGTTCTC
AGAAACACACGCCGACCCTCACAATTCCCGCCGTGGCTTCTTCTTCTCTCACGTGGGTTGGCTGCTTGTG
CGCAAACACCCGGCTGTCAAAGAGAAGGGCGGAAAACTGGACATGTCTGACCTGAAAGCCGAGAAGCTGG
TGATGTTCCAGAGGAGGTACTACAAGCCTGGCATTCTGCTGATGTGCTTCATCCTGCCCACGCTGGTGCC
CTGGTACTGCTGGGGCGAGACTTTTCTAAACAGTTTTTATGTTGCCACTTTACTGAGATACGCTGTGGTG
CTCAACGCCACTTGGCTGGTGAACAGTGCCGCCCACCTCTACGGGTATCGCCCCTACGATAAGAACATCG
ATCCCCGGCAGAATGCCCTGGTTTCCTTGGGAAGTATGGGCGAGGGCTTCCACAACTACCACCATGCCTT
CCCCTACGACTACTCTGCCAGTGAGTACCGCTGGCACATCAACTTCACCACGTTCTTCATCGACTGCATG
GCTGCACTGGGCCTGGCTTACGACCGGAAGAGAGTGTCCAAGGCCACTGTCTTAGCCAGGATTAAGAGAA
CTGGAGACGGGAGTCACAAGAGTGGCTGAATTTGGAGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 65915. Forward Primer - name:065915_F_cDNA_Scd3, sequence:ACGTCTGGAGGAACATCATTCT; Reverse Primer - name:065915_N_SP6_cDNA_Scd3, sequence:ACTCCAAATTCAGCCACTCTTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20078 same embryo
 EMAGE:20079 same embryo
 EMAGE:20080 same embryo
 EMAGE:20081 same embryo
 EMAGE:20077 same embryo
 EurExpress:euxassay_012236 same experiment
 MGI:4827891 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS