Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20659

Ttbk1 tau tubulin kinase 1 ( MGI:2147036)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20659 EMAGE:20659 EMAGE:20659 EMAGE:20659 EMAGE:20659
"Pseudo-wholemount" of euxassay_013947. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013947_01 euxassay_013947_02 euxassay_013947_03 euxassay_013947_04
EMAGE:20659 EMAGE:20659 EMAGE:20659 EMAGE:20659 EMAGE:20659
euxassay_013947_05 euxassay_013947_06 euxassay_013947_07 euxassay_013947_08 euxassay_013947_09
EMAGE:20659 EMAGE:20659 EMAGE:20659 EMAGE:20659 EMAGE:20659
euxassay_013947_10 euxassay_013947_11 euxassay_013947_12 euxassay_013947_13 euxassay_013947_14
EMAGE:20659 EMAGE:20659 EMAGE:20659 EMAGE:20659 EMAGE:20659
euxassay_013947_15 euxassay_013947_16 euxassay_013947_17 euxassay_013947_18 euxassay_013947_19
EMAGE:20659 EMAGE:20659 EMAGE:20659
euxassay_013947_20 euxassay_013947_21 euxassay_013947_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20659Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20659_wholemount_strong.wlz
20659_wholemount_moderate.wlz
20659_wholemount_weak.wlz
20659_wholemount_possible.wlz
20659_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20659_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 18 19
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 08 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 16 17 18 19 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09 16
ventral grey horn
moderate moderate
regionalmoderate expression: see section 10
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 15 16
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39363
Entity Detected:Ttbk1, tau tubulin kinase 1 ( MGI:2147036)
Sequence:sense strand is shown

>T39363
CTGAGCCACAGAGAGCAAACTAAGACATTCTGGTGAAGGCAGGCCTCCGTATGCCACCGGCCTGGTCATG
TCTACACCCGTGATGACTGTCTGGGAGCTGCTCATGCCAGCTGAACTCCTCACATAGGGTCAGCGGGTGT
GGGCAGTCGTTTCCATGCCAAGAGGGCAGCTCTACAGACCAGCTGGGGAGGGCACCAGGGTGGATAGGCT
TTGAGATCTATCCCACGCTGACACAGAAGCTCCCAGAACACTCAGGAAACCTCTCTGGATGCAGTTATCT
TTGTCACCCCAAGGCCCTCTAATTGTCTCCTAGTCCCGGGAAGGGGCAGAGGGCTCACTTCCTCCCACCC
AGAGCTTTTATGAATGACAATCAGCTCATGCCAGGTGGGGACCAGGGCATGATCCCAGCGCCCAGACCCT
GGGCCTGCCCCTTGCCACCAACCTAACTGTGAGTGTAGGTGCCCCCCTCAGTCTCCCTTCTGCCGTAGGA
CCAACAACACCCAGGTTTGGAGATTGAAAGAAGGGGAGGCCTAGGAAAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 68527. Forward Primer - name:068527_F_cDNA_C330008L01Rik, sequence:CTGAGCCACAGAGAGCAAACTA; Reverse Primer - name:068527_N_SP6_cDNA_C330008L01Rik, sequence:CTTTCCTAGGCCTCCCCTTCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20660 same embryo
 EMAGE:20656 same embryo
 EMAGE:20655 same embryo
 EMAGE:20657 same embryo
 EMAGE:20658 same embryo
 EurExpress:euxassay_013947 same experiment
 MGI:4828975 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS