Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20660

6720401G13Rik RIKEN cDNA 6720401G13 gene ( MGI:2147989)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20660 EMAGE:20660 EMAGE:20660 EMAGE:20660 EMAGE:20660
"Pseudo-wholemount" of euxassay_013928. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013928_01 euxassay_013928_02 euxassay_013928_03 euxassay_013928_04
EMAGE:20660 EMAGE:20660 EMAGE:20660 EMAGE:20660 EMAGE:20660
euxassay_013928_05 euxassay_013928_06 euxassay_013928_07 euxassay_013928_08 euxassay_013928_09
EMAGE:20660 EMAGE:20660 EMAGE:20660 EMAGE:20660 EMAGE:20660
euxassay_013928_10 euxassay_013928_11 euxassay_013928_12 euxassay_013928_13 euxassay_013928_14
EMAGE:20660 EMAGE:20660 EMAGE:20660 EMAGE:20660 EMAGE:20660
euxassay_013928_15 euxassay_013928_16 euxassay_013928_17 euxassay_013928_18 euxassay_013928_19
EMAGE:20660 EMAGE:20660 EMAGE:20660 EMAGE:20660 EMAGE:20660
euxassay_013928_20 euxassay_013928_21 euxassay_013928_22 euxassay_013928_23 euxassay_013928_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20660Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20660_wholemount_strong.wlz
20660_wholemount_moderate.wlz
20660_wholemount_weak.wlz
20660_wholemount_possible.wlz
20660_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20660_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
thymus primordium
strong strong
regionalstrong expression: see section 11 moderate expression: see section 12 13 14 15
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 19 moderate expression: see section 10 16 17 18
thyroid gland
strong strong
regionalstrong expression: see section 11 15 16
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa epidermal component
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 19 20 21 22 23 24
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13 14 15
diencephalon roof plate
moderate moderate
regionalmoderate expression: see section 13 14
choroid invagination
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 15 16 17 18 19 20 21 22
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 15 16 17 18 19 20 21 22 23 24
medulla oblongata floor plate
moderate moderate
regionalmoderate expression: see section 13 14
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 15 16 17 18 19 20 21
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 08 11 12 15
metencephalon floor plate
moderate moderate
regionalmoderate expression: see section 13 14
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 15 16 17 18 19 20 21 22
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 15 16 17 18 19 20 21 22
metencephalon part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 19 20 21 22
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 18 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 09
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 18 19
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14
dorsal root ganglion
strong strong
regionalstrong expression: see section 08 09 10 12 13 14 15 16 17 18
endolymphatic duct
strong strong
regionalstrong expression: see section 02 03 22 23
cochlea
strong strong
regionalstrong expression: see section 07 08 09 10 17 18 19
utricle
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 18 19 20 21 22 23 24
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 02 03 04 05 moderate expression: see section 01
cornea epithelium
strong strong
regionalstrong expression: see section 01 02 03 04 23 24
anterior naris epithelium
strong strong
regionalstrong expression: see section 11 12 15 16
external naris epithelium
strong strong
regionalstrong expression: see section 11 12 15 16
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 09 10 11 12 14 15 16 17 18 19
naso-lacrimal duct
strong strong
regionalstrong expression: see section 03 04 05 06 07 20 21 22 23 24
esophagus epithelium
strong strong
regionalstrong expression: see section 13
pharynx epithelium
strong strong
regionalstrong expression: see section 11 12 13
tongue epithelium
strong strong
regionalstrong expression: see section 11 12 13 14 15 16
tongue muscle
strong strong
regionalstrong expression: see section 11 12 13 14 15 16
stomach
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10
midgut
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
lower jaw incisor
strong strong
regionalstrong expression: see section 11 12 15 16
lower jaw molar
strong strong
regionalstrong expression: see section 07 08 09 19 20
oral epithelium
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
upper jaw incisor
strong strong
regionalstrong expression: see section 11 12 15 16
upper jaw molar
strong strong
regionalstrong expression: see section 07 08 09 19 20
bladder
strong strong
regionalstrong expression: see section 10 11 12
kidney calyx
moderate moderate
regionalmoderate expression: see section 07 08 16
renal cortex
moderate moderate
regionalmoderate expression: see section 06 07 08 09 15 16 17 18
urethra of male
strong strong
regionalstrong expression: see section 10 11
larynx
strong strong
regionalstrong expression: see section 12 13 14
left lung
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12
right lung
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19 20 21 22 23
trachea epithelium
strong strong
regionalstrong expression: see section 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39355
Entity Detected:6720401G13Rik, RIKEN cDNA 6720401G13 gene ( MGI:2147989)
Sequence:sense strand is shown

>T39355
ACAAGGAAGGCTAGAACTGCACAGTTAGTGGACACTACCTCTGTATTGACATTTTTTTCAGTCTGTGAAG
GCGGGGACAGAGAGCTGCAGCCAGGACACCTTCCCTGCTCTGGGGCAACACTGCCATCATGGGAAAATGT
TTTCTGTAGACCAGCTGAGGCACACACCCCTCCTCCATCCTGCTTCTCCTCAGCCATTTTGAAGCAGGGA
GGATGAGGGGGATTCATGAATGGCGAAGCTTGCCCATTTTACTGTATTTCTCTCCTACTGTGGGCAGACT
GGCATCACCCGACCCTTCAGAGTATTAATGCAGACCTTCGTGACAGAGGTCCAGTACCAAGTGCGCAGCT
GTGCTGAGGTCCAGGGACAGAAAGCAGATGGGCAGATTCAACCCCCCTCAGCTGGCCATGCTAATCTACT
AGCTGGTGTCCTAGGGCAGCAGGGTGCCTCCCTCTCCAGGTTCTGATGAGAAAACACTGCAGTCCCAGTT
TCTTTCGGGGCTTGAAGAGAAGTCAAGGAAGCCCTGCAAGGCACTCACAGCTGATCATGCTGTCTGTAAT
TGGCTGCCATCTTCTGCCATTGCTAGGAATCATGGGAAGGAGGACAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 86416. Forward Primer - name:086416_F_cDNA_6720401G13Rik, sequence:ACAAGGAAGGCTAGAACTGCAC; Reverse Primer - name:086416_N_SP6_cDNA_6720401G13Rik, sequence:ATGTCCTCCTTCCCATGATTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20656 same embryo
 EMAGE:20659 same embryo
 EMAGE:20655 same embryo
 EMAGE:20657 same embryo
 EMAGE:20658 same embryo
 EurExpress:euxassay_013928 same experiment
 MGI:4822789 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS