Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21124

Pex16 peroxisomal biogenesis factor 16 ( MGI:1338829)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21124 EMAGE:21124 EMAGE:21124 EMAGE:21124 EMAGE:21124
"Pseudo-wholemount" of euxassay_007808. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007808_01 euxassay_007808_02 euxassay_007808_03 euxassay_007808_04
EMAGE:21124 EMAGE:21124 EMAGE:21124 EMAGE:21124 EMAGE:21124
euxassay_007808_05 euxassay_007808_06 euxassay_007808_07 euxassay_007808_08 euxassay_007808_09
EMAGE:21124 EMAGE:21124 EMAGE:21124 EMAGE:21124 EMAGE:21124
euxassay_007808_10 euxassay_007808_11 euxassay_007808_12 euxassay_007808_13 euxassay_007808_14
EMAGE:21124 EMAGE:21124 EMAGE:21124 EMAGE:21124 EMAGE:21124
euxassay_007808_15 euxassay_007808_16 euxassay_007808_17 euxassay_007808_18 euxassay_007808_19
EMAGE:21124 EMAGE:21124 EMAGE:21124
euxassay_007808_20 euxassay_007808_21 euxassay_007808_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21124Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21124_wholemount_strong.wlz
21124_wholemount_moderate.wlz
21124_wholemount_weak.wlz
21124_wholemount_possible.wlz
21124_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21124_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2665
Entity Detected:Pex16, peroxisomal biogenesis factor 16 ( MGI:1338829)
Sequence:sense strand is shown

>T2665
CAGAGACAGGATGGAGNAAGCTACGGCTCCTGCAGCCTCCGCTACCAGGAGTATGTGACTCGTCATCCAG
CCGCCACGGACCCAGTTGGAGACGGCTGTGCGGGGCCTCAGTTACCTGCTGGCAGGTCGCTTCTCCGATT
CACACGAGCTGTCTGAACTGGTGTACTCTGCCTCGAACCTGCTGGTGCTGCTCAATGACGGGATCCTGAG
GAAGGAGCTTCGAAAAAAGTTGCCTGTGTCGCTGTCCCAGCAGGAAGTTGCTGACATGGCTGAGTGTACT
GGAGTGTGTGGAGGTGTTCATGGAGATGGGGGCTGCCAAGGTGTGGGGCGAAGTAGGCCGTTGGCTCGTC
ATTGCTCTCATCCAGTTGGCCAAGGCCGTCCTGCGCATGCTCCTGTTGATCTGGTTCAAGGCTGGCATTC
AGACATCACCCCCCATTGTTCCACTGGACAGGGTAAACTCAGGCACAGCCCTTGGATGGTGACCACAA
Notes:The probe template was PCR amplified from IMAGE:1510981 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1510981 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_007808 same experiment
 EMAGE:21121 same embryo
 EMAGE:21122 same embryo
 EMAGE:21123 same embryo
 EMAGE:21125 same embryo
 EMAGE:21126 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS