Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21394

Krit1 KRIT1, ankyrin repeat containing ( MGI:1930618)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21394 EMAGE:21394 EMAGE:21394 EMAGE:21394 EMAGE:21394
euxassay_002826_01 euxassay_002826_02 euxassay_002826_03 euxassay_002826_04 euxassay_002826_05
EMAGE:21394 EMAGE:21394 EMAGE:21394 EMAGE:21394 EMAGE:21394
euxassay_002826_06 euxassay_002826_07 euxassay_002826_08 euxassay_002826_09 euxassay_002826_10
EMAGE:21394 EMAGE:21394 EMAGE:21394 EMAGE:21394 EMAGE:21394
euxassay_002826_11 euxassay_002826_12 euxassay_002826_13 euxassay_002826_14 euxassay_002826_15
EMAGE:21394 EMAGE:21394 EMAGE:21394 EMAGE:21394 EMAGE:21394
euxassay_002826_16 euxassay_002826_17 euxassay_002826_18 euxassay_002826_19 euxassay_002826_20
EMAGE:21394 EMAGE:21394 EMAGE:21394
euxassay_002826_21 euxassay_002826_22 euxassay_002826_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21394Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21394_wholemount_strong.wlz
21394_wholemount_moderate.wlz
21394_wholemount_weak.wlz
21394_wholemount_possible.wlz
21394_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21394_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 5 6 6 7
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 2 3 4 5 6 7 5 6 7 8 9 0
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 6 7
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 6 7 8 9 0 4 5 6
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2183
Entity Detected:Krit1, KRIT1, ankyrin repeat containing ( MGI:1930618)
Sequence:sense strand is shown

>T2183
NNCCANAANACTANATATGCATATACTCCTGCNTGCCCAATTTTTTACTGCTTACAAGATATTATGAGAG
TTTGTAGTGAATCCAGTACTCACTTTGCAACACTTACAGCAAGGATGTTAATAGCCTTGGATAAGTGGTT
AGATGAACGTCATGCGCAGTCTCACTTTATTCCAGCTTTATTCCGACCTTCTCCCCTTGAACGGATAAAG
ACAAATGTCATAAACCCTGCGTATGCTGCTGAATTAGGCCAGGTAGACAATTCACTACATATGGGCTATA
GTGCACTAGAAATAAAGAGTAAAATGCTAGCCCTAGAGAAAGCAGACACCTGCATTTACAACCCTTTGTT
TGGATCAGATCTTCAGNATACAAATCGGGTAGATAAAGTGGTAATAAATCCATACTTTGGTCTCGGAGCT
CCAGACTACTCAAAAATCCAAATTCCCNAACANGAAAAATGGCANNCGAAGCATGAG
Notes:The probe template was PCR amplified from IMAGE:891306 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:891306 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002826 same experiment
 EMAGE:21395 same embryo
 EMAGE:21397 same embryo
 EMAGE:21396 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS