Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:21643

Polr2l polymerase (RNA) II (DNA directed) polypeptide L ( MGI:1913741)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:21643 EMAGE:21643 EMAGE:21643 EMAGE:21643 EMAGE:21643
"Pseudo-wholemount" of euxassay_019574. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019574_01 euxassay_019574_02 euxassay_019574_03 euxassay_019574_04
EMAGE:21643 EMAGE:21643 EMAGE:21643 EMAGE:21643 EMAGE:21643
euxassay_019574_05 euxassay_019574_06 euxassay_019574_07 euxassay_019574_08 euxassay_019574_09
EMAGE:21643 EMAGE:21643 EMAGE:21643 EMAGE:21643 EMAGE:21643
euxassay_019574_10 euxassay_019574_11 euxassay_019574_12 euxassay_019574_13 euxassay_019574_14
EMAGE:21643 EMAGE:21643 EMAGE:21643 EMAGE:21643 EMAGE:21643
euxassay_019574_15 euxassay_019574_16 euxassay_019574_17 euxassay_019574_18 euxassay_019574_19
EMAGE:21643 EMAGE:21643 EMAGE:21643 EMAGE:21643 EMAGE:21643
euxassay_019574_20 euxassay_019574_21 euxassay_019574_22 euxassay_019574_23 euxassay_019574_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:21643Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
21643_wholemount_strong.wlz
21643_wholemount_moderate.wlz
21643_wholemount_weak.wlz
21643_wholemount_possible.wlz
21643_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:21643_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
strong strong
regionalstrong expression: see section 8 9 0 1 7 9 moderate expression: see section 2 3 4 5 6 8
pancreas
weak weak
regionalweak expression: see section 9 0 1 2 6 7 8
vibrissa
moderate moderate
regionalmoderate expression: see section 6 7 8 1 2 3
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 5 6 0 1
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 7 8 9
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 3 4 5 6 7 8 9 8 9 0 1 2 3
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 9 8
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 8 9
dorsal root ganglion
strong strong
regionalstrong expression: see section 8 moderate expression: see section 8 9 0 1 7
esophagus
moderate moderate
regionalmoderate expression: see section 3 4
stomach
strong strong
regionalstrong expression: see section 2 3 4 moderate expression: see section 5 6 7 8 9 0
midgut
moderate moderate
regionalmoderate expression: see section 6 7 8 9 0 1 2 3 4 5 6 7 weak expression: see section 8 9
lower jaw incisor
strong strong
regionalstrong expression: see section 7 moderate expression: see section 2 3 weak expression: see section 6
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 2 3 weak expression: see section 6 7
liver
moderate moderate
regionalmoderate expression: see section 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4
testis
moderate moderate
regionalmoderate expression: see section 6 7 8 0 1 2
lung
moderate moderate
regionalmoderate expression: see section 5 6 8 9 0 4 5 7 8 1 2 3 4 weak expression: see section 7 1 2 3 6 9 0
nucleus pulposus
strong strong
regionalstrong expression: see section 4
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55151
Entity Detected:Polr2l, polymerase (RNA) II (DNA directed) polypeptide L ( MGI:1913741)
Sequence:sense strand is shown

>T55151
CCATCAGCTGTGTGAGCCTATCTGCTGCCCATGCCTGAGGATCTTGTTTCCAGAATCTTCCCAGGCCCGA
CAGCTAGGCAGCCCTGCCCCTTGACCCAATCCCCACAGCATGTAGTCCTAAGAAGCCTACTCTAGGCCAA
AGGAGGTGGTGTAGTGCTTTAGCTCCTAGGCATCTGCATCAAGTACCCCGGGTTCTTTCTAGCACATTGA
TCCCTTTGAGAATTTTGGTGGGTTTTTTTGTTTTGTTTTTTGAGACCAGCTTTGGCTGGTTTGAAACTCA
CAACAGTCAGCCTGCCTTTACCTCTTGGATTCTGGGATTAAAGGTGTGTGTGGCATAGCATACCCACCCT
ACCCCACCCCTGGTTTTTTGTTGTTTTAAAGAAAAAGGCGGGCTGGTGAGATGGCTCAGTGGGTAAGAGC
ACCCAACTGCTCTTCCAAAGGTCCAGAGTTCAAATCCCAGC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:CCATCAGCTGTGTGAGCCTA; Reverse Primer - name:unspecified, sequence:GCTGGGATTTGAACTCTGGA. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_019574 same experiment
 EMAGE:21642 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS