Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:29166

Slc7a4 solute carrier family 7 (cationic amino acid transporter, y+ system), member 4 ( MGI:2146512)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:29166 EMAGE:29166 EMAGE:29166 EMAGE:29166 EMAGE:29166
euxassay_002905_01 euxassay_002905_02 euxassay_002905_03 euxassay_002905_04 euxassay_002905_05
EMAGE:29166 EMAGE:29166 EMAGE:29166 EMAGE:29166 EMAGE:29166
euxassay_002905_06 euxassay_002905_07 euxassay_002905_08 euxassay_002905_09 euxassay_002905_10
EMAGE:29166 EMAGE:29166 EMAGE:29166 EMAGE:29166 EMAGE:29166
euxassay_002905_11 euxassay_002905_12 euxassay_002905_13 euxassay_002905_14 euxassay_002905_15
EMAGE:29166 EMAGE:29166 EMAGE:29166 EMAGE:29166 EMAGE:29166
euxassay_002905_16 euxassay_002905_17 euxassay_002905_18 euxassay_002905_19 euxassay_002905_20
EMAGE:29166 EMAGE:29166 EMAGE:29166 EMAGE:29166
euxassay_002905_21 euxassay_002905_22 euxassay_002905_23 euxassay_002905_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T329
Entity Detected:Slc7a4, solute carrier family 7 (cationic amino acid transporter, y+ system), member 4 ( MGI:2146512)
Sequence:sense strand is shown

>T329
GCTTCTCTGGCATCCTGGCTGGCACAGCCACCTGTTTCTATGCCTTCGTGGGATTTGATGTTATTGCTGC
CTCCAGTGAGGAGGCCAAAAACCCACGGTGGGCGGTGCCCATGGCCATCGCCATCTCCCTCAGCCTGGCA
GCTGGTGCCTATATTCTGGTCTCCACTGTGTTAACCCTCATGGTACCTTGGCACAGCCTAGACCCTGACT
CGGCGCTTGCTGATGCTTTCTACAGGCGGGGTTACAGCTGGGCTGGCTTCATTGTGGCAGTTGGCTCTAT
CTGTGCCATGAACACCGTCCTGCTCAGCAACCTCTTCTCCCTGCCGCGCATTGTCTACGCCATGGCTGCC
GATGGGCTCTTCTTCCAGGTGTTTGCCCGTGTACACCCCCGGACACAGGTGCCTGTGGTAGGAATCCTGG
TGTTTGGGGTCCTCATGGCCCTCCTGGCACTGCTGCTGGACCT
Notes:The probe template was PCR amplified from IMAGE:3154471 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3154471 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002905 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS