Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:29192

Zfp319 zinc finger protein 319 ( MGI:1890618)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:29192 EMAGE:29192 EMAGE:29192 EMAGE:29192 EMAGE:29192
euxassay_008210_01 euxassay_008210_02 euxassay_008210_03 euxassay_008210_04 euxassay_008210_05
EMAGE:29192 EMAGE:29192 EMAGE:29192 EMAGE:29192 EMAGE:29192
euxassay_008210_06 euxassay_008210_07 euxassay_008210_08 euxassay_008210_09 euxassay_008210_10
EMAGE:29192 EMAGE:29192 EMAGE:29192 EMAGE:29192 EMAGE:29192
euxassay_008210_11 euxassay_008210_12 euxassay_008210_13 euxassay_008210_14 euxassay_008210_15
EMAGE:29192 EMAGE:29192 EMAGE:29192 EMAGE:29192 EMAGE:29192
euxassay_008210_16 euxassay_008210_17 euxassay_008210_18 euxassay_008210_19 euxassay_008210_20
EMAGE:29192 EMAGE:29192 EMAGE:29192
euxassay_008210_21 euxassay_008210_22 euxassay_008210_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T351
Entity Detected:Zfp319, zinc finger protein 319 ( MGI:1890618)
Sequence:sense strand is shown

>T351
AGTGGTTCTGAGCTGCAGGGGAATGAGTGTGCCCAGAGCAGAGCTGCGGTGTGGAAGTGGAGGACTGTTA
GTCCCCTGACCTTCATCCCTGGGTTGGGGAGGAAGGAAGACCAAGCCTATGATTTCCCGGCAGATGTAAA
CAGGTCCCTTCCTATGTCATGTGAACCAAAGTGTCCGGGGCTCAGAGTCATAGGCTTGTCCCAGCCCTGC
CTGAGGGCCAAAGGGAGTCCCAGGTATCCAGGGTGAGGACTGTCCTCTTACCCCCACAGAGCCCCCAGGC
CCTAAGGATCGTCCATTGCTGTAACAACCTGCTGTCTTTTGAGCCCTGGGAACCCTACCCCCACCCCCCA
GGTCTTTGGCTTCTCACAGCCTGCTTCCTGTAGCAGATGTGGGTACACAAGGAGTGGGAAGCCCAGCAGG
CAGCATTCTTGGTAGGTACACGGTCAGCCACCATCACTGGATGGCCAGA
Notes:The probe template was PCR amplified from IMAGE:3155206 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3155206 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_008210 same experiment
 EMAGE:30818 same embryo
 EMAGE:29463 same embryo
 EMAGE:29177 same embryo
 EMAGE:29176 same embryo
 EMAGE:29465 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS