EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:29465

AW494914 ( MGI:2147067)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


euxassay_008192_01	euxassay_008192_02	euxassay_008192_03	euxassay_008192_04	euxassay_008192_05

euxassay_008192_06	euxassay_008192_07	euxassay_008192_08	euxassay_008192_09	euxassay_008192_10

euxassay_008192_11	euxassay_008192_12	euxassay_008192_13	euxassay_008192_14	euxassay_008192_15

euxassay_008192_16	euxassay_008192_17	euxassay_008192_18	euxassay_008192_19	euxassay_008192_20

euxassay_008192_21	euxassay_008192_22	euxassay_008192_23	euxassay_008192_24

View assay images:
Expression pattern clarity:

Expression Pattern Description

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T336
Entity Detected:	AW494914, ( MGI:2147067)
Sequence:	sense strand is shown >T336 TTCGACAGCCCCTACCTGTTGTACCATGAGAAAATCAAAACTAGCCGGGTGTTCATCCGAGACTGCAGCA TGGTGTCTGTGTATCCCCTGGTCTTGTTTGGAGGGGGCCAAGTGAACGTGCAGCTTCAAAGAGGGGCGTT CGTCGTCTCCTTGGATGACGGCTGGATCCGGTTTGTGGCCGCCTCCCACCAGGTGGCCGAGCTGGTGAAG GAACTCCGCTGCGAACTTGACCAGCTCCTCCAGGATAAGATTAAAAACCCCAGCATGGACCTGTGCAGCT GTCCGAGGGGCTCTCGGATTATCAGCATGATCGTGAAGCTCTTCACCACACAGTGACGACTGGGCCTGGC CGCCTGCTCTGCACCTCTGCTCCCCGGCAAGGCACAGGAGCGCGCCTACCTCCCACGGAAGACTGGCTTG GGGCTGCCCCTGGGGTGCAGAGCCAGGGCCCCACAACCCAAGAGACAGTC
Notes:	The probe template was PCR amplified from IMAGE:3154580 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3154580 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_008192 same experiment
	EMAGE:29192 same embryo
	EMAGE:30818 same embryo
	EMAGE:29463 same embryo
	EMAGE:29177 same embryo
	EMAGE:29176 same embryo
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source