EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:29725

Rfwd2 ring finger and WD repeat domain 2 ( MGI:1347046)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


euxassay_001748_01	euxassay_001748_02	euxassay_001748_03	euxassay_001748_04	euxassay_001748_05

euxassay_001748_06	euxassay_001748_07	euxassay_001748_08	euxassay_001748_09	euxassay_001748_10

euxassay_001748_11	euxassay_001748_12	euxassay_001748_13	euxassay_001748_14	euxassay_001748_15

euxassay_001748_16	euxassay_001748_17	euxassay_001748_18	euxassay_001748_19	euxassay_001748_20

euxassay_001748_21	euxassay_001748_22	euxassay_001748_23	euxassay_001748_24

View assay images:
Expression pattern clarity:

Expression Pattern Description

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T2766
Entity Detected:	Rfwd2, ring finger and WD repeat domain 2 ( MGI:1347046)
Sequence:	sense strand is shown >T2766 TAGTTTCCTGAAGTCAAACTGTGTTTGATCCTCCCAAAAGCCATCTGCAGCTGATGATGAGAAGAAAAAG AAATGGCATGTAATGTCTCCCCCAACATCATTTGGATTTGTTTTAAGTACCTTTTCCCTCCTTTATGCCT TTGGGACACTGGGAATATCCAGAGAATTCGCCACCATCAGTGTAACTATGAACTTTGCTGTTGGCAGTGT GGCTAATTTTTGTGATAGGGAAACAAATTCTTTTAAATAAAAATAATAAACAACAACAACAAAAAGTTTA TTGAGCCACAGCTGAGCTAGGAACACCTTTTTGTCAGATGGGGTGAGAGTCTTTTGAAGAAGTTGCACTT ATGGGTTATACAGAATGTTCTGGCTGGGGCTGGAGAGAGGCTCAGAGAATAAGAGCACTGGTCGCTCCTA CAGAGGATCTGGGTTCAGTCCCCAGCACCTACGTAGCAGCTCACTGCTGCTTATGATTCCAGTAGGAGAT CTGACGTCCTCTTCTGGGCTCCTTAAGCACCAGGCATGCATGTGGTGCACATTCAAAGA
Notes:	The probe template was PCR amplified from IMAGE:1514782 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1514782 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Strain:	C57BL/6
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_001748 same experiment
	EMAGE:31801 same embryo
	EMAGE:31724 same embryo
	EMAGE:30723 same embryo
	EMAGE:29662 same embryo
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source