Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:29853

Ankrd27 ankyrin repeat domain 27 (VPS9 domain) ( MGI:2444103)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:29853 EMAGE:29853 EMAGE:29853 EMAGE:29853 EMAGE:29853
euxassay_012324_01 euxassay_012324_02 euxassay_012324_03 euxassay_012324_04 euxassay_012324_05
EMAGE:29853 EMAGE:29853 EMAGE:29853 EMAGE:29853 EMAGE:29853
euxassay_012324_06 euxassay_012324_07 euxassay_012324_08 euxassay_012324_09 euxassay_012324_10
EMAGE:29853 EMAGE:29853 EMAGE:29853 EMAGE:29853 EMAGE:29853
euxassay_012324_11 euxassay_012324_12 euxassay_012324_13 euxassay_012324_14 euxassay_012324_15
EMAGE:29853 EMAGE:29853 EMAGE:29853 EMAGE:29853 EMAGE:29853
euxassay_012324_16 euxassay_012324_17 euxassay_012324_18 euxassay_012324_19 euxassay_012324_20
EMAGE:29853 EMAGE:29853 EMAGE:29853
euxassay_012324_21 euxassay_012324_22 euxassay_012324_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31256
Entity Detected:Ankrd27, ankyrin repeat domain 27 (VPS9 domain) ( MGI:2444103)
Sequence:sense strand is shown

>T31256
TTCATCGTCTCCCAAGCCTGGAGCCTCAGCTGGTTAATCGTTTTGAAGTTTGAGAGCTACTCAAGAAACT
GAACGTTAAGCCCTTAATTGATTGTGAGAGCTGGTGTGATACCAGTGGGATTTACACTGTCAGTAGCCGG
CTCCATTAATCCTGCCATCTTCAGGAGCCCGAGTGTGGGGAAGGGAGCCAGATACAGCAGATCAGGACTC
TGTGGCCTTATTATTGCTTCCTTGGTTGGTGAGCTTTGGTGAGAGAGAGCAGATCTGTTTCTATGTAAAT
TATGGGAGTCTTAAGCTCAGGTTTCACCACGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4221252), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 63799. Forward Primer - name:063799_F_IRAV49_d10_Ankrd27, sequence:TTCATCGTCTCCCAAGCC; Reverse Primer - name:063799_R_SP6_IRAV49_d10_Ankrd27, sequence:CCCGTGGTGAAACCTGA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012324 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS