EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:29870

Cela3b chymotrypsin-like elastase family, member 3B ( MGI:1915118)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


euxassay_003016_01	euxassay_003016_02	euxassay_003016_03	euxassay_003016_04	euxassay_003016_05

euxassay_003016_06	euxassay_003016_07	euxassay_003016_08	euxassay_003016_09	euxassay_003016_10

euxassay_003016_11	euxassay_003016_12	euxassay_003016_13	euxassay_003016_14	euxassay_003016_15

euxassay_003016_16	euxassay_003016_17	euxassay_003016_18	euxassay_003016_19	euxassay_003016_20

euxassay_003016_21	euxassay_003016_22	euxassay_003016_23	euxassay_003016_24

View assay images:
Expression pattern clarity:

Expression Pattern Description

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T1112
Entity Detected:	Cela3b, chymotrypsin-like elastase family, member 3B ( MGI:1915118)
Sequence:	sense strand is shown >T1112 GCTGGAATCACCCTGAAGCTCACCATGCTCCGACTGCTGAGTTCCCTCCTGCTTGTGGCCCTTGCCTCAG GCTGTGGACAGCCTTCCCACAACCCCTCCAGCCGAGTTGTCAATGGCGAGGAAGCTGTTCCCCACAGCTG GCCCTGGCAGGTCTCCCTTCAGTATGAGAAGGATGGGAGCTTCCACCATACCTGTGGTGGCTCCCTCATT ACCCCTGACTGGGTTCTGACTGCGGGCCACTGCATCTCGACTTCTCGCACCTACCAGGTTGTACTTGGGG AGCATGAACGTGGTGTGGAGGAAGGCCAAGAACAGGTGATCCCCATCAACGCTGGAGACCTCTTTGTGCA CCCCAAGTGGAACTCTATGTGTGTGAGCTGTGGCTATGACATCGCCCTGGTCAAGCTCTCAAGAAGTGCC CAGCTGGGAGATGCAGTCCAGCTTGCCTGCCTCCCTCCTGCTGGTGAAATCCTACCCAACGGAGCACCCT GTTACATCAGCGGCTGGGGCCGGCTCTCCACCAATGGACCTCTGCCGGACAAGCTGCAGCAGGCCTTGCT GCCTGTGGT
Notes:	The probe template was PCR amplified from IMAGE:2135327 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2135327 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_003016 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source